Overview

Comprehensive Description

Biology

Abundant in all inshore habitats where there is adequate cover, such as seagrass beds and reef flats. Feeds on mollusks, crustaceans and echinoderms (Ref. 36453). Generally common (Ref. 9710). Traded as an aquarium fish at Ceará, Brazil (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Massachusetts, USA to São Paulo, Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts, USA to Santa Catarina, Brazil (Ref. 57756). Replaced by Sphoeroides marmoratus in the eastern Atlantic (P. Wirtz, pers. comm. 10/04).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic and eastern central Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 180 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 26999))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

11-14 sharply defined round black spots on head and lower side of body. The numerous tan lappers on the rear part of the body and distinct spots along the lower side make it unmistakable (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 2 - 70 m (Ref. 26999)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 0 - 84
  Temperature range (°C): 13.162 - 27.542
  Nitrate (umol/L): 0.174 - 2.951
  Salinity (PPS): 32.865 - 36.604
  Oxygen (ml/l): 4.350 - 6.156
  Phosphate (umol/l): 0.038 - 0.407
  Silicate (umol/l): 0.805 - 2.415

Graphical representation

Depth range (m): 0 - 84

Temperature range (°C): 13.162 - 27.542

Nitrate (umol/L): 0.174 - 2.951

Salinity (PPS): 32.865 - 36.604

Oxygen (ml/l): 4.350 - 6.156

Phosphate (umol/l): 0.038 - 0.407

Silicate (umol/l): 0.805 - 2.415
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Abundant in all inshore habitats where there is adequate cover, such as seagrass beds and reef flats. Feeds on mollusks, crustaceans and echinoderms (Ref. 36453). Generally common (Ref. 9710). Omnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphoeroides spengleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGCCCTAAGCCTCCTCATTCGGGCAGAGCTAAGCCAACCCGGCGCACTCTTAGGTGACGACCAAATTTATAATGTAATCGTCACAGCCCATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGATTAATTCCGCTTATGATCGGGGCCCCCGACATGGCGTTCCCCCGAATGAACAACATAAGCTTCTGACTCCTGCCCCCCTCTTTCCTTCTTCTGCTTGCCTCCTCTGGGGTTGAAGCCGGGGCTGGAACAGGATGAACCGTCTACCCCCCTCTAGCCGGAAACCTGGCACACGCAGGGGCCTCCGTAGATCTAACCATCTTTTCCCTACATCTTGCAGGTGTTTCTTCGATTCTAGGGGCCATTAACTTCATCACCACCATTATTAACATGAAACCCCCTGCCATTTCGCAATACCAAACACCCCTGTTTGTATGAGCCGTACTAATTACTGCCGTCCTTCTTCTACTTTCCCTCCCTGTCCTTGCAGCCGGCATTACAATGCTTCTTACAGACCGAAACCTGAACACAACCTTCTTTGACCCGGCGGGCGGAGGGGATCCTATCCTTTATCAACATCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphoeroides spengleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!