Overview

Comprehensive Description

Biology

Inhabit holes or crevices in rocky areas (Ref. 2850). Territorial (Ref. 2850). Viviparous, with planktonic larvae (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Pacific: Eureka in northern California, USA to central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 5 - 7; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 390 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

39.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 30 years (Ref. 39268)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 7 (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Sebastes carnatus
Catalog Number: USNM 27098
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1881. Proceedings of the United States National Museum. 3 (176): 73.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Sebastes carnatus
Catalog Number: USNM 26993
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Type: Jordan, D. S. & Gilbert, C. H. 1881. Proceedings of the United States National Museum. 3 (176): 73.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 55 m (Ref. 2850), usually 15 - 55 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 55m.
Recorded at 55 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous (Ref. 36715, 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes carnatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCCCGTATGAATAACATAAGCTTCTGACTTCTACCCCCCTCTTTCCTATTACTACTTGCCTCTTCTGGGGTAGAAGCGGGTGCCGGAACCGGATGAACAGTATACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTAGACCTAACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTTGGGGCAATCAATTTTATCACCACAATTATTAATATGAAACCCCCAGCCATCTCTCAATACCAGACACCCTTATTTGTGTGAGCCGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCAGGAGGAGGAGATCCGATCCTTTACCAGCACTTATTCTGGTTTTTTGGGCACCCAGAAGTATATATTCTCATTCTACCCGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGTATGGTATGGGCAATAATGGCTATTGGCCTTCTAGGCTTTATTGTATGAGCCCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCTTATTTCACGTCTGCCACAATAATCATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTAGCCAATTCATCCCTAGATATTGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes carnatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gopher rockfish

The gopher rockfish (Sebastes carnatus) (also known as the Gopher Seaperch) is a rockfish of the Pacific coast, primarily off California.

Gopher rockfish have a generally mottled appearance, with dark areas generally olive to reddish brown, and the lighter areas being white or maybe pinkish. The upper part of the back almost always has three light patches extending into the dorsal fins, and the lighter areas become more extensive ventrally. They range in size up to about 40 cm.

They are known from as far north as Cape Blanco in Oregon, down to Punta San Roque in southern Baja California. They can be found in the intertidal zone, but most occur at depths of 12–80 metres, living in crevices and holes during the day, and ranging further abroad at night to feed on benthic crustacea, cephalopods, and some types of fishes. They are territorial, claiming an area of 10–12 square metres.

Gophers are extremely closely related to the black-and-yellow rockfish S. chrysomelas; S. chrysomelas is darker brown with yellow patches, and tends to prefer shallower water. While it was once thought that the black-and-yellow and gopher rockfish were merely color morphs of the same species, detailed genomic studies using microsatellite analysis have recently shown, however, that there is a significant amount of genetic difference between the two at loci that code for more than just coloration. This implies that they are indeed distinct, albeit closely related species, making them ideal specimens for studying sympatric evolution.

References[edit]

  • Shawn Narum, Vincent Buonaccorsi, Carol Kimbrell, and Russell Vetter. (2004). Genetic Divergence between Gopher Rockfish (Sebastes carnatus) and Black and Yellow Rockfish (Sebastes chrysomelas). Copeia, 4, pp. 926–931.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!