Overview

Comprehensive Description

Biology

Occur just above the bottom, sometimes found in rocky caverns and crevices (Ref. 27436). Ovoviviparous (Ref. 6885). Rarely caught by anglers (Ref. 27436). Filleted and sold indiscriminately with other rockfish; flavor and texture of flesh particularly good (Ref. 27436).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Pacific: Bering Sea coast of Alaska (Ref. 27436) to Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 710 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

71.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 4,710 g (Ref. 40637); max. reported age: 82 years (Ref. 39247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head spines weak - nasal, preocular and parietal spines present, supraocular, postocular, tympanic, coronal and nuchal spines absent (Ref. 27437). Lower jaw long and protruding beyond upper jaw; distinct symphyseal knob; maxillary extends to rear of orbit (Ref. 27437). Caudal fin indented (Ref. 6885). Greenish to silver gray, white tinged with orange or pink ventrally; lips dusky (Ref. 27437).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 375m.
Recorded at 375 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 375 m (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 339 specimens in 1 taxon.
Water temperature and chemistry ranges based on 230 samples.

Environmental ranges
  Depth range (m): 2.455 - 242.5
  Temperature range (°C): 6.508 - 8.018
  Nitrate (umol/L): 21.193 - 30.351
  Salinity (PPS): 33.089 - 33.926
  Oxygen (ml/l): 2.565 - 4.195
  Phosphate (umol/l): 1.970 - 2.545
  Silicate (umol/l): 34.086 - 46.902

Graphical representation

Depth range (m): 2.455 - 242.5

Temperature range (°C): 6.508 - 8.018

Nitrate (umol/L): 21.193 - 30.351

Salinity (PPS): 33.089 - 33.926

Oxygen (ml/l): 2.565 - 4.195

Phosphate (umol/l): 1.970 - 2.545

Silicate (umol/l): 34.086 - 46.902
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous (Ref. 6885). Also Ref. 34817.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 82 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes brevispinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGCCATTATAATTGGAGGTTTTGGNAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTACTACTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCTGGTAATTTAGCCCACGCAGGAGCATCAGTCGACTTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAATATAAAGCCCCCGGCCATCTCTCAATACCAGACACCCCTATTTGTGTGAGCGGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCTCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCAGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTTTTTGGACACCCAGAAGTATATATTCTTATTCTGCCTGGCTTTGGTATAATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGCATAGTATGAGCAATAATGGCCATTGGCCTCCTAGGCTTTATTGTATGAGCTCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCTTATTTCACGTCTGCCACAATAATCATCGCAATTCCCACCGGTGTTAAAGTATTTAGCTGACTTGCAACCCTACATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTGGCCAATTCATCACTAGATATTGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACGTACTATCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes brevispinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!