Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Meso- and bathypelagic (Ref. 58302). Found in midwater, usually greater than 610 m (Ref. 35598). Oviparous, with planktonic eggs and leptocephali (Ref. 35598). Relatively rare (Ref. 35598).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Circumglobal in all oceans. Eastern Atlantic: Gibraltar to the Azores and Madeira; South Africa (Ref. 6593). Eastern Indian Ocean: Australia (Ref. 7300). Southwest Pacific: New Zealand (Ref. 5755). Eastern Pacific: Oregon, USA to Panama (Ref. 35598), and Chile (Ref. 9068).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in all oceans, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 6538))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Black in color (Ref. 6593).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 330 - 5100 m (Ref. 6538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 152 - 3250
  Temperature range (°C): 1.384 - 18.997
  Nitrate (umol/L): 1.492 - 44.722
  Salinity (PPS): 34.004 - 36.586
  Oxygen (ml/l): 0.303 - 6.271
  Phosphate (umol/l): 0.074 - 3.251
  Silicate (umol/l): 0.993 - 160.312

Graphical representation

Depth range (m): 152 - 3250

Temperature range (°C): 1.384 - 18.997

Nitrate (umol/L): 1.492 - 44.722

Salinity (PPS): 34.004 - 36.586

Oxygen (ml/l): 0.303 - 6.271

Phosphate (umol/l): 0.074 - 3.251

Silicate (umol/l): 0.993 - 160.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 5100m.
Recorded at 5100 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in midwater, usually greater than 610 m (Ref. 35598). Meso- and bathypelagic (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyema atrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TAATAATTTTCTTTATAGTAATACCAGTAATAATTGGCGGCTTCGGCAATTGATTAATCCCCCTAATAATTGGAGCTCCAGACATAGCATTCCCTCGTATAAATAACATAAGCTTCTGACTCCTCCCCCCCTCTTTCCTTCTACTACTGGCTTCTTCAGGGGTAGAGGCCGGAGCTGGTACGGGATGAACTGTGTACCCGCCCCTATCCGGGAACCTAGCCCATGCAGGAGCATCCGTCGACTTAACCATCTTCTCCCTACATCTTGCAGGTATTTCCTCCATCCTGGGGGCCATCAATTTTATTACCACTATCATTAACATAAAACCGCCCTCCGTAACTCAGCACCAAACCCCCCTGTTTGTCTGAGCTGTACTAGTCACCGCAGTTCTACTATTATTATCCCTCCCAGTTTTAGCCGCCGGCATCACAATACTTTTAACAGACCGAAATCTAAACACAACATTTTTTGACCCCGCCGGGGGGGGGGACCCAATTCTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyema atrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cyema atrum

Cyema atrum is a species of deep-water bobtail snipe eel in the family Cyematidae. It is the only member of its genus Cyema. It is found globally at depths of 330 meters to 5100 meters.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!