Overview

Comprehensive Description

Biology

A little-known reef shark found in shallow water on the continental and insular shelves, but may range in deeper water (Ref. 244). Feeds on small fishes and crabs (Ref. 244). Viviparous (Ref. 50449). Rather skittish and timid when approached (Ref. 244). Probably harmless or minimally hazardous to people (Ref. 244). Utilized for human consumption (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Occurs on continental and insular shelves in shallow water in sub-tropical and tropical waters of northern Australia, Papua New Guinea (P.N.G.) and the Solomon Islands. It seems likely that this species may also be found in the intervening waters around east P.N.G. The southern extent of its range on the east coast of Australia has been recently extended following the capture of mature adults and young sharks in Moreton Bay, Queensland (Kyne et al., in prep.). It is the most common carcharhinid in Darwin Harbour (Northern Territory), which lies at the centre of this species? range. It is one of the six most common near-shore species on the eastern side of the Gulf of Carpentaria (Queensland) and is also common in Shark Bay (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: southern New Guinea, Solomon Islands, and northern Australia (including Western Australia, Ref. 7300).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

150 cm TL (male/unsexed; (Ref. 244)); 150 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Grey or light brown above, white below; dorsal, caudal, and pectoral fins with black margins, expanded apically to black tips on caudal fin lobes and pectoral fins; probably a conspicuous white band on flank (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in shallow warm, coastal waters including large embayments. They may be more common in areas that are fringed by mangroves, possibly preferring a sand/mud substrate, although they are also found in areas away from mangroves (Lyle 1987, White et al. 2002). The species is often found in association with C. melanopterus, C. dussumieri, C. amblyrhynchos, C. sorrah, C. tilsoni, C. fitzroyensis and Rhizoprionodon acutus. Very similar to C. melanopterus (but lacks conspicuous black tips to the first dorsal and anal fins) and may have been confused in parts of its range. It is reported to reach 150 cm total length (TL) (Last and Stevens 1994) although other data suggest males reach about 120 cm and females 140 cm TL (White et al. 2002). Males are thought to mature at about 79 to 84 cm TL and females at about 91 cm TL from Darwin, Northern Territory (Lyle 1987), but at 91 cm TL and 101 cm TL respectively from Shark Bay, Western Australia (White et al. 2002). Testes mass peaks in January, with sperm present in seminal vesicles in February/March (Lyle 1987). White et al. (2002) report ovulation and conception occurring in December. It seems likely that copulation occurs over a period of two or three months in mid/late-summer (December to March). Gestation lasts 10 months with a litter size of 2 to 6, produced every other year. Young are born at 33?39 cm TL. Males mature at 4 to 5 years of age and reach maximum body size by about 12 years. Females mature at 6 to 7 years, reaching a maximum size at about 16 years. Carcharhinus cautus has a varied diet, primarily consisting of teleost fishes, followed in importance by crustaceans (prawns, crabs, mantid shrimps) and molluscs (Lyle 1987, Salini et al. 1992). There are records of this species taking terrestrial snakes, indicating an opportunistic feeding behaviour (Lyle and Timms 1987).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 15 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449). Size at birth between 35 and 39 cm (Ref. 244). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16.4 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus cautus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGCATAGTTGGAACAGCTCTTAGCCTACTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGGGATGATCAGATTTATAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTTCCCCTAATAATTGGTGCACCAGACATAGCCTTTCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCCGGAGCAGGTACTGGCTGAACAGTATATCCACCGTTAGCTAGCAACTTAGCACATGCTGGGCCATCTGTTGATTTAGCTATTTTTTCTCTTCACTTAGCTGGTGTATCATCAATTTTAGCCTCAATTAATTTTATTACAACCATTATTAACATAAAACCACCAGCCATTTCCCAGTATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTACTTCTCCTTTCACTTCCAGTTCTTGCAGCAGGGATTACTATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGACCCTGCAGGGGGAGGAGATCCAATCCTCTATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus cautus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Bennett, M.B. & Kyne, P.M. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
This species is apparently common in shallow warm coastal waters and embayments within its range (northern Australia, Papua New Guinea and Solomon Islands). Females mature at 5 to 6 years and reach maximum size at 16 years. Litters of 2 to 6 are produced at two-year intervals. Relatively little is known about its population structure and dynamics. It occurs in areas of northern Australia that are targeted by a moderate level of prawn trawling and coastal/estuarine gillnetting. This species is probably taken as a bycatch in both fisheries, but with a greater likelihood of being caught in the inshore gillnet fishery. Discard/release mortality is probably significant but these fisheries are not thought to be detrimental to the Australian population (where this species is assessed as Least Concern). It will also be taken (and presumably not discarded) in shallow coastal gillnet and line fisheries elsewhere in its range, where no data are available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no data on the populations of this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is threatened primarily by inshore gill-net fisheries throughout its range. In Australia it is the barramundi (Lates calcarifer) fishery that poses the greatest threat. Smaller individuals may also be taken as bycatch in the prawn trawl fisheries to the north of Australia. It will also be taken in shallow coastal gill net and line fisheries elsewhere in its range, where no data are available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The broad distribution and common occurrence of C. cautus is offset by the susceptibility of the species to inshore gill-net fisheries. Future research should examine the level of bycatch in these fisheries, together with their attendant mortalities. An education program aimed at encouraging release of sharks would have a limited effect, as individual sharks caught in nets die quickly of hypoxia. Practical action in the form of net restrictions will be the only effective measure. Research into population sizes and movements of individuals, via tag-release-recapture studies, is required to better understand this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nervous shark

The nervous shark (Carcharhinus cautus) is a species of requiem shark, family Carcharhinidae, so named because of its timid behavior with regard to humans. It is common in shallow, coastal waters off northern Australia, Papua New Guinea, and the Solomon Islands. A small brownish or grayish shark typically measuring 1.0–1.3 m (3.3–4.3 ft) long, this species has a short, blunt snout, oval eyes, and a relatively large second dorsal fin. The leading margins of most fins are finely edged with black, and the lower caudal fin lobe is black-tipped.

Small bony fishes are the main prey of the nervous shark, while crustaceans, molluscs, and snakes may also be taken. It is viviparous, with the developing embryos nourished through a placental connection. The details of its life history seem to vary depending on latitude—for example, the timing of the breeding season and the length of the gestation period. Females produce litters of one to six young either annually or biennially. The harmless nervous shark is caught incidentally by coastal gillnet fisheries and perhaps also by line and trawl fisheries. The International Union for Conservation of Nature (IUCN) lacks sufficient data to assess the conservation status of this species except in Australian waters, where its population seems healthy and has been listed under Least Concern.

Taxonomy and phylogeny[edit]

Australian ichthyologist Gilbert Percy Whitley originally described the nervous shark as a subspecies of Galeolamna greyi (a junior synonym of Carcharhinus obscurus, the dusky shark), in a 1945 issue of the scientific journal Australian Zoologist. He gave it the name cauta, meaning "cautious" in Latin, because of its skittish demeanor when confronted by people.[3] Later authors have recognized this shark as a distinct species, placed in the genus Carcharhinus. The type specimen consists of the preserved skin and teeth of a 92 cm (36 in) long female caught in Shark Bay, Western Australia.[4]

Based on morphology, Jack Garrick suggested in 1982 that the nervous shark is closely related to the blacktip reef shark (C. melanopterus).[5] Leonard Compagno in 1988 tentatively grouped these two species with the blacknose shark (C. acronotus), the copper shark (C. brachyurus), the silky shark (C. falciformis), and the night shark (C. signatus).[6] The close relationship between the nervous and blacktip reef sharks was upheld in a 1992 phylogenetic study by Shane Lavery, based on allozymes,[7] and again in a 2011 study by Ximena Vélez-Zuazoa and Ingi Agnarsson, based on nuclear and mitochondrial genes.[8]

Description[edit]

The nervous shark has a rather stout, spindle-shaped body and a short, broadly rounded snout. The anterior margin of each nostril is extended into a slender nipple-shaped lobe. The moderately large eyes are horizontally oval in shape and equipped with nictitating membranes. The mouth lacks conspicuous furrows at the corners and contains 25–30 upper and 23–28 lower tooth rows. The upper teeth are narrow and angled, with coarsely serrated edges. The lower teeth are more slender and upright in shape, and have finer serrations. The five pairs of gill slits are medium in length.[2][4]

The pectoral fins are moderately long, narrow, and pointed. The first dorsal fin originates over the free rear tips of the pectoral fins; it is large and falcate (sickle-shaped) with a pointed apex. The second dorsal fin is positioned opposite the anal fin and is relatively large and high. There is no ridge between the dorsal fins. A crescent-shaped notch is present on the caudal peduncle just before the upper caudal fin origin. The caudal fin is asymmetrical, with a strong lower lobe and a longer upper lobe with a ventral notch near the tip.[2][4] The dermal denticles are overlapping and bear three horizontal ridges (five in larger individuals) leading to marginal teeth.[9] This species is bronze to gray above and white below, with a white stripe on the flank. A thin black line runs along the leading margins of the dorsal fins, pectoral fins, and the upper caudal fin lobe, as well as the caudal fin trailing margin; the lower caudal fin lobe and sometimes the pectoral fins are also tipped in black.[2] The nervous shark typically reaches 1.0–1.3 m (3.3–4.3 ft) in length and may grow up to 1.5 m (4.9 ft) long.[9] Females attain larger sizes than males.[10]

Distribution and habitat[edit]

The nervous shark is found over continental and insular shelves off northern Australia from Shark Bay in the west to Moreton Bay in the east, as well as off Papua New Guinea and around the Solomon Islands.[2] It is among the most common sharks in Darwin Harbor, the Gulf of Carpentaria, and Shark Bay.[1] This species generally inhabits shallow inshore waters, to a depth of at least 45 m (148 ft).[9] It seems to particularly favor mangrove-lined areas with sandy-muddy bottoms and avoids areas with dense seagrass cover.[1][11]

Biology and ecology[edit]

The snake Cerberus rynchops is sometimes eaten by the nervous shark.

The diet of the nervous shark consists mainly of small teleost fishes (including silversides, smelt-whitings, wrasses, and grunters). Crustaceans (including prawns, crabs, and mantis shrimps) and molluscs (predominantly cephalopods but also bivalves and gastropods) constitute secondary food sources.[12][13] This shark is also known to occasionally prey on the semiaquatic snakes Cerberus rynchops and Fordonia leucobalia.[14] A known parasite of the nervous shark is the myxosporean Kudoa carcharhini.[15]

Like other requiem sharks, the nervous shark is viviparous: once the embryos exhaust their initial supply of yolk, they are provisioned by the mother through a placental connection formed from the depleted yolk sac. Adult females have a single functional ovary, on the right, and two functional uteruses. The male bites at the sides of the female as a prelude to mating. After mating, the female stores the sperm for approximately four weeks prior to fertilization. In Darwin Harbor, mating occurs from January to March and birthing occurs in October and November following a gestation period of eight to nine months. In Shark Bay, mating occurs from late October to early November and birthing occurs around the same time the following year, following a gestation period of 11 months; this slower development likely reflects the cooler temperatures of Shark Bay.[10][16]

Females produce litters on an annual cycle in Darwin Harbor and on a biennial cycle in Shark Bay. The litter size ranges from one to six and is not correlated with the size of the female. The newborns are relatively large, measuring 35–40 cm (14–16 in) long, and are birthed in shallow nursery areas such as Herald Bight in Shark Bay. The juvenile growth rate is high for a shark; males and females mature sexually at around 84 and 91 cm (33 and 36 in), respectively, in Darwin Harbour, and 91 and 101 cm (36 and 40 in), respectively, in Shark Bay. The age at maturity is around four years for males and six years for females; the maximum lifespan is at least 12 years for males and 16 years for females.[10][16]

Human interactions[edit]

Shy and difficult to approach, the nervous shark is harmless to humans.[4] It is occasionally marketed for food.[2] This species is susceptible to being caught incidentally in coastal gillnets, such as the barramundi (Lates calcarifer) gillnet fishery operating off northern Australia. It may also be caught on line gear and in prawn trawls. The Australian nervous shark population does not appear to be threatened by fishing activities, and there the International Union for Conservation of Nature (IUCN) has assessed it as Least Concern. No data on the impact of fishing are available elsewhere in its range, and thus the IUCN has listed it overall under Data Deficient.[1]

References[edit]

  1. ^ a b c d Bennett, M.B.; Kyne, P.M. (2003). "Carcharhinus cautus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. 
  2. ^ a b c d e f Last, P.R.; Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. p. 256–257. ISBN 0-674-03411-2. 
  3. ^ Whitley, G.P. (June 11, 1945). "New sharks and fishes from Western Australia, Part 2". Australian Zoologist 11 (1): 1–42. 
  4. ^ a b c d Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization of the United Nations. pp. 468–469. ISBN 92-5-101384-5. 
  5. ^ Garrick, J.A.F. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS CIRC 445.
  6. ^ Compagno, L.J.V. (1988). Sharks of the Order Carcharhiniformes. Princeton University Press. pp. 319–320. ISBN 0-691-08453-X. 
  7. ^ Lavery, S. (1992). "Electrophoretic analysis of phylogenetic relationships among Australian carcharhinid sharks". Australian Journal of Marine and Freshwater Research 43 (1): 97–108. doi:10.1071/MF9920097. 
  8. ^ Vélez-Zuazoa, X.; Agnarsson, I. (February 2011). "Shark tales: A molecular species-level phylogeny of sharks (Selachimorpha, Chondrichthyes)". Molecular Phylogenetics and Evolution 58 (2): 207–217. doi:10.1016/j.ympev.2010.11.018. 
  9. ^ a b c Voigt, M.; Weber, D. (2011). Field Guide for Sharks of the Genus Carcharhinus. Verlag Dr. Friedrich Pfeil. pp. 56–57. ISBN 978-3-89937-132-1. 
  10. ^ a b c White, W.T.; Hall, N.G.; Potter, I.C. (December 2002). "Size and age compositions and reproductive biology of the nervous shark Carcharhinus cautus in a large subtropical embayment, including an analysis of growth during pre- and postnatal life". Marine Biology 141 (6): 1153–1164. 
  11. ^ White, W.T.; Potter, I.C. (October 2004). "Habitat partitioning among four elasmobranch species in nearshore, shallow waters of a subtropical embayment in Western Australia". Marine Biology 145 (5): 1023–1032. doi:10.1007/s00227-004-1386-7. 
  12. ^ Salini, J.P.; Blaber, S.J.M.; Brewer, D.T. (1992). "Diets of sharks from estuaries and adjacent waters of the north-eastern Gulf of Carpentaria, Australia". Australian Journal of Freshwater and Marine Research 43: 87–96. 
  13. ^ White, W.T.; Platell, M.E.; Potter, I.C. (March 2004). "Comparisons between the diets of four abundant species of elasmobranchs in a subtropical embayment: implications for resource partitioning". Marine Biology 144 (3): 439–448. doi:10.1007/s00227-003-1218-1. 
  14. ^ Lyle, J.M.; Timms, G.J. (August 5, 1987). "Predation on Aquatic Snakes by Sharks from Northern Australia". Copeia 1987 (3): 802–803. JSTOR 1445681. 
  15. ^ Gleeson R.J.; Bennett M.B.; Adlard R.D. (November 2010). "First taxonomic description of multivalvulidan myxosporean parasites from elasmobranchs: Kudoa hemiscylli n.sp. and Kudoa carcharhini n.sp. (Myxosporea: Multivalvulidae)". Parasitology 137 (13): 1885–1898. doi:10.1017/S0031182010000855. 
  16. ^ a b Lyle, J.M. (1987). "Observations on the biology of Carcharhinus cautus (Whitley), C. melanopterus (Quoy & Gaimard) and C. fitzroyensis (Whitley) from Northern Australia". Australian Journal of Marine and Freshwater Research 38 (6): 701–710. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!