Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in rubble-strewn surge channels, the outermost reaches of exposed reef flats, and the upper submarine terrace at 12 meters. Territorial but they generally occur in groups, and remains close to shelter. Feed mainly on benthic algae and small crustaceans (Ref. 1602, 37816 ). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Marquesan and Society islands, north to Japan, south to Australia.
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Marquesas Islands, north to southern Japan, south to Western Australia, New South Wales (Australia), New Caledonia and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 11 - 13
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

8.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species occurs in 2 basic color phases: a blue-backed (leucopoma) phase and a gray to black (amabilis) phase usually with 2 light bars (Ref. 37816). Large blue-edged black spot at end of dorsal fin base, and yellow form with black spots at end of dorsal fin and its base (Ref. 48636). Body depth 2.3-2.5 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 12 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 117 specimens in 1 taxon.
Water temperature and chemistry ranges based on 94 samples.

Environmental ranges
  Depth range (m): 0.305 - 20
  Temperature range (°C): 25.245 - 29.264
  Nitrate (umol/L): 0.016 - 2.136
  Salinity (PPS): 33.762 - 35.924
  Oxygen (ml/l): 4.444 - 4.806
  Phosphate (umol/l): 0.086 - 0.501
  Silicate (umol/l): 0.912 - 4.844

Graphical representation

Depth range (m): 0.305 - 20

Temperature range (°C): 25.245 - 29.264

Nitrate (umol/L): 0.016 - 2.136

Salinity (PPS): 33.762 - 35.924

Oxygen (ml/l): 4.444 - 4.806

Phosphate (umol/l): 0.086 - 0.501

Silicate (umol/l): 0.912 - 4.844
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits surge channels, exposed reef flats and upper submarine terrace. Territorial but found in groups (Ref. 37816). Feeds on plants (e.g. benthic algae) and invertebrates (e.g. small crustaceans) (Ref. 6110, 37816).
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera brownriggii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCCTTAAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCGCACTCCTAGGAGACGACCAAATCTACAATGTTATCGTAACTGCACATGCCTTTGTAATAATTTTTTTTATAGTTATACCTATCCTTATTGGAGGATTTGGAAACTGACTAGTCCCCTTAATGCTGGGAGCCCCCGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTTCTCCCCCCATCATTCCTTCTCCTACTCACCTCTTCTGGGGTCGAAGCAGGGGCCGGAACAGGCTGAACAGTCTACCCCCCACTATCTGGGAACCTTGCCCATGCAGGAGCATCAGTAGACCTAACAATCTTCTCTCTTCACCTGGCAGGTATTTCATCAATCCTGGGGGCAATCAACTTTATTACCACCATCATCAACATAAAACCCCCCGCCATCTCACAATACCAAACCCCACTGTTCGTATGAGCCGTCCTGATCACTGCCGTCCTTCTTCTCCTGTCACTTCCAGTTTTAGCTGCTGGCATTACCATGCTCTTGACCGATCGAAATCTTAACACCACTTTCTTTGACCCGGCAGGGGGAGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera brownriggii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!