Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The conger is also called a sea eel. Contrary to true eel, congers only live in sea water. They can reach up to three meters in length. Divers usually only see their head because they are often hiding between stones or in ship wrecks. It's not a good idea to pat a conger. They have very sharp teeth. There are stories of scuba divers that were swept for several meters by raging congers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found on rocky and sandy bottoms (Ref. 12382). Depth range from 0-500 m (Ref. 4453) and from 305-1171 m in the eastern Ionian Sea (Ref. 56504). It stays near the coast when young and moves toward deeper waters upon reaching adulthood (Ref. 5377). A nocturnal (Ref. 12382) predator of fish, crustaceans, and cephalopods (Ref. 6521). Like other species of the group, it reproduces only once in its life (Ref. 5377). Sexually mature at an age of 5-15 years. Spawn in summer in the Atlantic off Portugal and in the Mediterranean. Produces 3-8 million of eggs (Ref. 35388). Marketed fresh and frozen. Eaten fried and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Conger conger is a long, powerful fish with scaleless, smooth skin. They are usually grey-blue or grey-black in colour with a white or pale golden coloured belly. In deeper water they have a light brown back with grey sides and belly. The dorsal, tail and anal fins are fused making a complete fringe around the body. The dorsal fin starts just behind the tip of the pectoral fin and the anal fin terminates midway along the underside of the fish. Conger eels can grow to 2.75 m in length but are more commonly seen at around 2 m long.Conger eels spend their entire life in marine waters. Once they reach maturity, which takes between 5 -15 years, they migrate to deep water in the mid-Atlantic to spawn. Conger conger spawns only once and dies straight after. The larvae drift north eastwards until they reach shallower waters where larval development is completed (Wheeler, 1969). Conger conger could be confused with the common eel Anguilla anguilla. However, the conger eel has pointed pectoral fins, the upper jaw overhangs the lower and the dorsal fin originates from further forward on the body.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The conger eel has a long, cylindrical body and smooth, scaleless skin. The dorsal fin starts just above the tip of the pointed pectoral fins and runs the length of the body, joining with the tail and anal fins. Two small, tube-like nostrils are conspicuous on the tip of the snout. Congers are usually slatey blue in colour with a lighter underside. They are large marine eels that can grow to approximately 2.75m in length although most are less than 2m. Juvenile congers might sometimes be confused with the common eel (Anguilla anguilla) however the latter has rounded pectoral fins and the dorsal fin starts much further back on the body.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic Europe, Azores, Azores Exclusive Economic Zone, Baltic sea, Black Sea, British Isles, De Panne, European waters (ERMS scope), Greek Exclusive Economic Zone, IJsselmeer, Irish Exclusive economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, North West Atlantic, Oostende, Oosterschelde, Portuguese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Norway and Iceland to Senegal. Also in the Mediterranean and Black Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Massachusetts to Uruguay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Baltic Sea, North Sea, Mediterranean Sea, Black Sea, eastern Atlantic: Iceland and Norway to Senegal including Madeira and Canary Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is common and widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 3000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 4453)); max. published weight: 110.0 kg (Ref. 35388)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 1171 m (Ref. 56504)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2184 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1444 samples.

Environmental ranges
  Depth range (m): -9 - 1000
  Temperature range (°C): 8.268 - 18.002
  Nitrate (umol/L): 1.069 - 17.472
  Salinity (PPS): 34.355 - 38.654
  Oxygen (ml/l): 4.081 - 6.346
  Phosphate (umol/l): 0.147 - 1.053
  Silicate (umol/l): 1.642 - 9.536

Graphical representation

Depth range (m): -9 - 1000

Temperature range (°C): 8.268 - 18.002

Nitrate (umol/L): 1.069 - 17.472

Salinity (PPS): 34.355 - 38.654

Oxygen (ml/l): 4.081 - 6.346

Phosphate (umol/l): 0.147 - 1.053

Silicate (umol/l): 1.642 - 9.536
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 During the day Conger conger are found in holes or crevices on rocky or sandy bottoms and in wrecks and other artificial environments. Conger eels become more active at night when they leave their resting places to hunt. Many Congers are found down to depths of 500 m but descend to as deep as 4000 m to spawn.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 500m.
Recorded at 500 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Congers are mostly encountered living amongst holes in rock or in artificial substrata such as wrecks, pier pilings, harbour walls etc. Young congers can sometimes be found in deep, seaweed covered rockpools on the low shore. They feed on a wide range of bottom-living fish, crabs and octopuses.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Conger conger is prey of:
Ciliata mustella
Aves

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Conger conger preys on:
Cirratulidae
Capitellidae
Maldanidae
Engraulis encrasicolus
Sardina pilchardus
Carcinus maenas
Crangon crangon
Nereis diversicolor

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are deposited in the open sea, at depths between 2,000 and 3,000 m (Ref. 12382).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conger conger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTAGGAACCGCATTAAGTCTGCTAATTCGAGCTGAATTAAGTCAACCTGGAGCTCTCCTTGGAGATGACCAGATCTATAATGTTATCGTAACAGCACATGCCTTTGTAATAATTTTCTTCATAGTAATACCAGTAATAATTGGAGGGTTTGGCAATTGACTAGTGCCACTAATAATTGGGGCCCCAGACATAGCATTTCCACGAATAAATAATATAAGCTTCTGATTATTACCTCCATCATTTCTTTTACTATTAACTTCATCTGGAGTTGAGGCCGGGGCAGGAACAGGATGAACTGTTTATCCCCCTCTGGCAGGGAATCTGGCCCACGCTGGAGCATCAGTTGACCTAACAATCTTTTCTCTACACCTAGCAGGAATTTCATCTATCCTTGGAGCTATTAACTTTATTACTACTATTATTAATATAAAACCACCAGCTACCACCCAATATCAAACCCCTCTATTTGTATGATCCGTTCTAGTCACCGCCGTACTGTTACTACTCTCCCTCCCAGTCCTTGCTGCCGGGATTACAATGCTTTTAACAGATCGAAATCTTAATACTACCTTCTTTGACCCAGCGGGTGGAGGGGACCCAATCCTTTACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Conger conger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European conger

The European conger, Conger conger, is a conger of the family Congridae.

Contents

Synonyms [edit]

Description and behavior [edit]

European congers have a common length of 150 cm (59 in), a maximum length of 3 m (9.8 ft), and weigh up to 110 kg (240 lb), making them the largest eels in the world.

The body is very long, anguilliform, without scales. The color is usually gray but can also be blackish. The belly is white. A row of white small spots is aligned along the lateral line. The head is almost conical, slightly depressed. The snout is rounded and prominent, with lateral olfactory holes. The large gill openings are in lateral position. The conical teeth are arranged in rows on jaws. The dorsal and anal fins are confluent with caudal. Pectoral fins are present, while ventral fins are absent.

Conger conger and a moray eel in one hole, at the Protected Marine Area of Portofino

The conger eels have habits similar to moray eels. They usually live amongst rocks in holes, or "eel pits", sometimes in one hole together with moray eels. They come out from their holes at night to hunt. This nocturnal predator mainly feeds on fish, cephalopods, and crustaceans. These fish have a long larval stage and reproduce only once in their life, at an age of 5-15 years. The female produces anywhere from 3-8 million eggs.

Distribution [edit]

This species can be found in the eastern Atlantic from Norway and Iceland to Senegal, and also in the Mediterranean and Black Sea.

Habitat [edit]

Conger conger ranges from 0-500 m of depth. It is sometimes seen in very shallow water by the shore, but can also go down to depths of 1,170 m (3,840 ft). It is usually present on rocky and sandy bottoms, close to the coast when young, moving to deeper waters when adult.

Gallery [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!