Overview

Comprehensive Description

Biology

Occurs in intertidal areas and down to at least 130 or 780 m depth (Ref. 5515). Usually found in subtidal areas of exposed coasts (Ref. 2850). Feeds on crustaceans (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Puffin Bay, southeastern Alaska to Santa Barbara Island, southern California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific: Kachemak Bay, northern Gulf of Alaska to southern California, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 18 - 20; Analspines: 0; Analsoft rays: 14 - 16; Vertebrae: 35
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 290 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

29.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal deeply notched between third and fourth spine, and between spinous and rayed portions; caudal rounded (Ref. 6885). Color brown, often tinged with red on dorsal surface, mottled and barred with 4 dark saddles over dorsal surface (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 780 m (Ref. 5515)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.915 - 168
  Temperature range (°C): 8.018 - 10.864
  Nitrate (umol/L): 4.910 - 23.221
  Salinity (PPS): 31.845 - 33.544
  Oxygen (ml/l): 3.625 - 6.421
  Phosphate (umol/l): 0.870 - 1.970
  Silicate (umol/l): 13.782 - 34.412

Graphical representation

Depth range (m): 0.915 - 168

Temperature range (°C): 8.018 - 10.864

Nitrate (umol/L): 4.910 - 23.221

Salinity (PPS): 31.845 - 33.544

Oxygen (ml/l): 3.625 - 6.421

Phosphate (umol/l): 0.870 - 1.970

Silicate (umol/l): 13.782 - 34.412
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 97m.
Recorded at 97 meters.

Habitat: demersal. Occurs in intertidal areas and up to 97 m depth. Usually found in subtidal areas of exposed coast. Feeds on crustaceans (Ref. 4925).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in intertidal areas and down to at least 130 or 780 m depth (Ref. 5515). Usually found in subtidal areas of exposed coasts (Ref. 2850). Feeds on crustaceans (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemilepidotus spinosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTAAGTCTCCTAATCCGAGCAGAGCTGAGCCAACCCGGAGCCCTTTTGGGGGACGACCAAATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGGGGCTTTGGAAACTGACTCATTCCTCTGATGATCGGCGCCCCCGACATAGCATTTCCTCGAATAAATAACATGAGCTTTTGGCTTCTTCCTCCCTCCTTTCTACTGCTCCTCGCCTCTTCAGGAGTAGAAGCAGGGGCCGGAACGGGATGAACAGTTTATCCCCCTCTTGCTGGTAACCTAGCACACGCAGGAGCCTCTGTTGACCTAACGATTTTCTCTCTCCATCTGGCAGGAATCTCCTCAATTCTTGGAGCCATCAATTTTATCACAACCATCATCAACATGAAACCTCCTGCCATCTCTCAGTACCAAACACCTCTTTTCGTGTGGTCCGTTCTTATTACCGCCGTCTTACTGCTTCTCTCCCTACCAGTCCTTGCTGCTGGCATCACAATGCTTCTAACAGACCGCAATCTCAACACTACCTTCTTCGATCCAGCAGGAGGTGGAGACCCCATTCTCTACCAGCACCTCTTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hemilepidotus spinosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!