Overview

Comprehensive Description

Biology

Found in rocky runs of small to medium rivers (Ref. 5723). Adults feed on terrestrial insects and sometimes supplemented with mayfly and caddisfly immatures (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (5000-20,000 square km (about 2000-8000 square miles)) Historical range included the Cahaba and Coosa river systems, in the Mobile Bay drainage above the Fall Line, Alabama, Georgia, and Tennessee; the species is now restricted to the Conasauga River and tributaries in Tennessee and Georgia, Coosawattee River and tributaries in Georgia, and Weogufka and Choccolocco creeks and lower Little River, tributaries of Coosa River in Alabama (Boschung and Mayden 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Coosa and Cahaba River systems from southeast Tennessee, northwest Georgia to Alabama, USA. Possibly extirpated from Cahaba River system.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AL, GA, TN)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 7 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 90 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 10294))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Lectotype for Photogenis caeruleus
Catalog Number: USNM 17883
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1876
Locality: Georgia: Rome, Etowah River., Floyd County, Georgia, United States, North America
  • Lectotype: Jordan, D. S. & Evermann, B. W. 1896. Bulletin of the United States National Museum. No. 47.: 277.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Photogenis caeruleus
Catalog Number: USNM 20114
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1876
Locality: Etowah River, Georgia, Georgia, United States, North America
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1896. Bulletin of the United States National Museum. No. 47.: 277.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes cool, clear, small to medium-sized rivers over firm substrates (sand, gravel, or rubble) in pools, backwaters, and areas of moderate current (Lee et al. 1980, Pierson and Krotzer 1987, Etnier and Starnes 1993, Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes cool, clear, small to medium-sized rivers over firm substrates (sand, gravel, or rubble) in pools, backwaters, and areas of moderate current (Lee et al. 1980, Pierson and Krotzer 1987, Etnier and Starnes 1993, Page and Burr 2011).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Spring and summer stomach samples contained mostly terrestrial insects supplemented with occasional mayfly and caddisfly immatures; probably a surface and mid-water feeder (Etnier and Starnes 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: In the 1990s, this species was thought to be represented by six populations (USFWS 1994). Not all of these have good viability.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

Unknown

Comments: Total adult population size is unknown. This species is regarded as local and uncommon (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns over an extended period in spring and summer; fractional spawner; most spawners are in their third summer, though some mature earlier (see Etnier and Starnes 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella caerulea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCTGGGATAGTGGGAACTGCTTTAAGCCTCCTTATTCGAGCTGAATTAAGTCAACCTGGCTCACTTCTAGGTGACGACCAGATCTATAATGTTATCGTTACTGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTTATTGGTGGGTTCGGAAACTGACTTGTGCCCCTAATGATCGGGGCACCTGATATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTCTTACCCCCATCATTCTTATTGCTATTGGCTTCTTCTGGTGTCGAAGCTGGGGCTGGGACAGGATGAACTGTGTACCCCCCACTTGCCGGTAACCTGGCTCACGCAGGGGCTTCAGTAGATCTCACAATCTTCTCTCTACACCTAGCAGGGGTATCCTCAATTCTAGGAGCAGTGAATTTCATCACTACAATTATTAATATAAAACCCCCAGCAATCTCTCAATACCAAACACCTCTCTTCGTATGGGCCGTACTTGTAACTGCCGTCCTTCTGCTACTTTCACTACCCGTCCTAGCTGCAGGAATTACTATACTCCTCACTGACCGTAACCTTAACACTACATTCTTTGACCCCGCAGGGGGAGGTGACCCTATTCTGTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella caerulea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Small range in Coosa River system of Alabama, Georgia, and Tennessee; good populations persist in the Conasauga River system in Georgia and Tennessee, but probably still declining overall; apparently extirpated in the Cahaba River system due to habitat alteration/degradation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B2ab(ii,iii,iv,v)

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Endangered because area of occupancy is probably less than 500 sq km, the distribution is severely fragmented, the species occurs in a small number of locations (fewer than six have good viability), and distribution, abundance, and habitat quality are subject to ongoing declines.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 04/22/1992
Lead Region:   Southeast Region (Region 4) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: T

For most current information and documents related to the conservation status and management of Cyprinella caerulea , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Trend over the past 10 years or three generations is uncertain but likely still declining.

Global Long Term Trend: Decline of 50-70%

Comments: This species is now apparently extirpated over much of its former range (Lee et al. 1980). Species is extirpated in the Cahaba River and reduced in numbers in much of its former range (Boschung and Mayden 2004). In the 1990s, the species was apparently declining in range and numbers (Etnier and Starnes 1993), though numbers were seasonally stable at one site that was sampled monthly for one year in the Little River (Dobson 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the 1990s, this species was thought to be represented by six populations (USFWS 1994). Not all of these have good viability.

Total adult population size is unknown. This species is regarded as local and uncommon (Page and Burr 2011).

This species is now apparently extirpated over much of its former range (Lee et al. 1980). It is extirpated in the Cahaba River and reduced in numbers in much of its former range (Boschung and Mayden 2004). In the 1990s, the species was apparently declining in range and numbers (Etnier and Starnes 1993), though numbers were seasonally stable at one site that was sampled monthly for one year in the Little River (Dobson 1994).

Trend over the past 10 years or three generations is uncertain but probably still declining.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Declines have been caused by water pollution, siltation, and construction of reservoirs for hydropower, navigation, and flood control (USFWS 1995; End. Sp. Tech. Bull. 16[5]:8). These degraded/destroyed habitat and fragmented populations. Current concerns include siltation and excessive nutrient inputs deriving from runoff from small-scale agriculture, grazing, and urbanization (USFWS 1995; J. M. Pierson, pers. comm., 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Declines have been caused by water pollution, siltation, and construction of reservoirs for hydropower, navigation, and flood control (USFWS 1995, End. Sp. Tech. Bull. 16[5]:8). These degraded/destroyed the habitat and fragmented the populations. Current concerns include siltation and excessive nutrient inputs deriving from runoff from small-scale agriculture, grazing, and urbanization (USFWS 1995, J. M. Pierson pers. comm. 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (B1+2ac)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See recovery plan (USFWS 1995).

Biological Research Needs: Hatchery spawning techniques need to be developed. If spawning in captivity can be achieved, a reintroduction to former habitat can be attempted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Needs: Protection needs include prevention of siltation of habitat, especially during the spawning period. Tennessee populations are dependent on protection of the Conasauga River (Etnier and Starnes 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Hatchery spawning techniques need to be developed. If spawning in captivity can be achieved, a reintroduction to former habitat can be attempted.

Known populations should be carefully monitored. Upstream and downstream limits in Weogufka and Choccolocco creeks and Little River in Alabama need to be determined.

Protection needs include prevention of siltation of habitat, especially during the spawning period. Tennessee populations are dependent on protection of the Conasauga River (Etnier and Starnes 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue shiner

Cyprinella caerulea, the blue shiner, is a species of shiner that is located in the southeastern area of the United States. It is listed as endangered under the IUCN and threatened under the federal government.[1] This paper includes strategies aimed at returning the blue shiner to stability by stopping the degradation of water quality. This species of shiner is endemic to the Cahaba and Coosa River systems of the Mobile Basin in Alabama. However, it now ranges from and is restricted to the Coosa River system in northeast Alabama, northwest Georgia, and southeast Tennessee. Blue shiners can be found in second to fourth order streams with a moderate to low river current. Being sight feeders, their diet consists of terrestrial and aquatic invertebrates found in drift. The life span of this species is only 3 years. [2] Current management practices put forth by the U.S. Fish and Wildlife Service include watershed protection, monitoring the populations, reducing threats, and increasing our knowledge about the species habitat requirements. Monitoring is especially important because it tracks the possible decline or increases in the populations. The objective of this management practice is delisting the blue shiner.[3]

Geographic Distribution[edit]

C. caerulea is a species that is endemic to the southeastern United States. Specifically it is native to the Cahaba and Coosa River systems of the Mobile Basin in Alabama. However, with populations declines, it is now restricted to the Coosa River system in four disjunct populations in northeast Alabama, northwest Georgia, and southeast Tennessee.[2] Within the Coosa River system, they were native to Choccolocco Creek, the Little River, Weogufka Creek, and Big Wills Creek in Alabama; the Coosawattee River the Oostanaula River in Georgia, and the Conasauga River in Georgia and Tennessee. The exact cause of this restriction and decline isn’t currently known. However, most people believe that it is caused by the degradation of habitat and water degradation caused by urbanization, pollution, and sedimentation.[4] The extirpation from the Cahaba River in Alabama could be due to extensive urban development.[5] Efforts are currently being made to reverse the effects of habitat and water degradation. If they are successful, the blue shiner may be delisted.

Ecology[edit]

Blue shiners are temperate, freshwater fish that occupy benthopelagic zones in streams.[6] They occur in second to fourth order streams with a moderate to low river currents. They favor a substrate of sand or sand and gravel that may or may not have cobble. They tend to occupy depths of 0.15 to 1 meters. C. caerulea requires high water clarity for feeding and reproduction. In the case of feeding, this is necessary because they are visual drift feeders. Their diet consists of terrestrial and aquatic invertebrates that are found in the drift of the water column. This is why sedimentation has such an adverse effect on them. Sedimentation causes turbidity which prevents them from seeing the invertebrates that they feed on.[7] Being only about three inches long, they are very susceptible to predation. This may include larger fish, turtles, or fishing birds. They most likely compete with other fish their size that occupies the same habitat. Urban development has as adverse effect on the abundance of the blue shiner by causing water degradation. A few factors of this water degradation include high algal blooms, nitrification, and low dissolved oxygen. This all contributes to the decline in abundance.[3]

Life History[edit]

The spawning season of the blue shiner starts in early May and ends in late August. With such a large spawning season, it is possible that there can be multiple clutches within one season. C. cyprinella uses crevices in bark and woody debris that has fallen into the river. They share a very similar spawning behavior with C. trichroistia and C. gibbsi. A single male will protect a territory and about four females will wait around the crevice waiting for an opportunity to spawn. Females will spawn several times and once they are done and gone, the male will pass over the crevice as a display to females.[8] Once the display is finished the eggs are left and receive little parental care. The life span of blue shiners is three years and they reach sexual maturity around two years. These two year old shiners make up the majority of the spawning stock. Sedimentation is a possible cause of population decline. This is caused by the sediment filling the crevices that the eggs are located in and suffocating them. This, along with other factors, may contribute in changes in life history of the blue shiner.[2] Sedimentation may also cause turbidity in the water that could affect reproduction as well. If the water is too turbid, the females may not see the males display themselves.[3]

Current Management[edit]

With water degradation being one of the main reasons for decline, there are many things that we as humans can do to reduce impacts on the species. Homesite development may have an adverse effect on stream flow because of the high demand for water it causes. A decrease in homesite development could restore stream flow. Other ways human impacts could be reduced is to stop the building of dams, reduce loss of habitat, and reduce water pollution. Habitat loss especially affects isolated populations. In August of 1995, the U.S. Fish and Wildlife Service (USFWS) implemented a recovery plan for the blue shiner. This was implemented three years after the blue shiner was put on the IUCN Red list. The USFWS has funded the Tennessee chapter of the Nature Conservancy to plan a watershed enhancement program for the Consauga River in Georgia and Tennessee. Public awareness is also being expressed through brochure sent out by the USFWS that tells how land management affects water quality. The Natural Resources Conservation Service (NRCS) is also a part of this recovery plan. Being a part of the U.S. Department of Agriculture, the NRCS has implemented a plan to reduce unfavorable effects on water quality in the Consauga River. This Recovery Plan aims to be successful through minimizing adverse effects and increasing knowledge on the different habitat requirements of the blue shiner. Watershed protection is essential to this and that is why the recovery plan is focused around them. Implementing this plan and monitoring its success is crucial to the recovery of the blue shiner.[3]

Management Recommendations[edit]

Currently, the largest population of C. caerulea is in the Conasauga River.[9] Therefore, this would be the most efficient area to sample the abundance of the species. To estimate the abundance, the best course of action would be to know the total area that a given population occupies. Then, divide that into subpopulations by equal areas that add up to the total area. Once the abundance of one subpopulation is found, the total population can be estimated by multiplying that subpopulation by the number of subpopulations within the total population. In other studies on the Cyprinella species, 700 volt AC backpack electrofishing equipment fishing was used.[10] However, using a large seine would be best when counting the subpopulations. Electrofishing wouldn’t cover as large of an area seining would. Also, the stress of getting shocked would most likely be greater than the stress of being caught in a seine. Since the blue shiner only lives for three years, it would be best to sample the population intermittently for a year or two. However, one would need to take into account the birth and death rates of the species. Currently, there is a program aimed at enhancing the Consauga River watershed. However, if improvements aren’t made soon, this watershed very well may need to be put under protection to help preserve remaining populations.

Literature Cited[edit]

  1. ^ NatureServe 2013. Cyprinella caerulea. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. <www.iucnredlist.org>.
  2. ^ a b c Stephens, C.M. and Mayden, R.L., Threatened Fishes of the World: Cyprinella caerulea Jordan, 1877 (Cyprinidae). Environmental Biology of Fishes 55(3) (1999): 264.
  3. ^ a b c d Stewart, J.H. and Larson, R., Blue shiner (Cyprinella caerulea) Recovery Plan. U.S. Fish and Wildlife Service (1999): 7.
  4. ^ George, A.L., Caldieraro, J.B., Chartrand, K.M., Mayden, R.L., Population Genetics of the Blue Shiner, Cyprinella caerulea. Southeastern Naturalist 7(4) (2008): 637-638.
  5. ^ Onorato, D., Angus, R.A., and Marion, K.R., Historical Changes in the Ichthyofaunal Asseblages of the Upper Cahaba River in Alabama Associated with Extensive Urban Development in the Watershed. Journal of Freshwater Ecology 15(1)(2000): 47
  6. ^ Cruz, T. and Ortañez, A.K., Cyprinella caerulea (Jordan, 1877). Fishbase.org.
  7. ^ U.S. Fish and Wildlife Service, Cyprinella caerulea. fws.gov.
  8. ^ Johnston, C. E. and J. R. Shute., Spawning behavior of the blue shiner (Cyprinella caerulea) and the holiday darter (Etheostoma brevirostrum), two rare fishes of the Conasauga River, Georgia and Tennessee. Proc. Southeast. Fish. Count. 35 (1997): l-2.
  9. ^ Conservation Fisheries, Inc., Cyprinella caerulea, Blue shiner. conservationfisheries.org.
  10. ^ Nuckols, D.R., and Roghair, C.N., Presence of Altamaha shiner (Cyprinella xaenura) and Ocmulgee shiner (Cyprinella callisema) within several Chattahoochee-Oconee National Forest streams. U.S. Forest Service Southern Research Station, Center for Aquatic Technology Transfer (2003): 3
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus Notropis and placed in genus (formerly subgenus) Cyprinella by Mayden (1989); this change was adopted in the 1991 AFS checklist (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!