Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A shallow water species; on hard substratum (Ref. 39287). Adults are collected usually from bays and many from tide pools (Ref. 54980). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: endemic to Marquesas Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South Pacific: Marquesas Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 15; Analspines: 2; Analsoft rays: 12 - 14; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 130 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.0 cm SL (male/unsexed; (Ref. 39287))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

A territorial species commonly found in coral reef areas with dead staghorn corals. Feeds on filamentous algae supported by these dead corals. Frequently charge human intruders without hesitation, sometimes taking painful nips which are mildly alarming when unexpected. Particularly aggressive during reproductive periods. Emit a clicking noise during aggressive encounters.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body dark reddish brown with edges of scales narrowly darker brown; black spot in axil and upper half of pectoral fin base. Body depth, 2-2.3 in SL. Preorbital width above end of maxilla 1/2 or more orbit diameter; margin of suborbital and posterior margin of preopercle strongly serrated. Suborbital scaled; scales on snout extending slightly anterior to nostrils. Tubed lateral line scales 19-20 (Ref. 39287).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 5 m (Ref. 39287)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 0.5 - 16
  Temperature range (°C): 26.671 - 29.241
  Nitrate (umol/L): 0.050 - 0.806
  Salinity (PPS): 32.200 - 35.322
  Oxygen (ml/l): 4.427 - 4.700
  Phosphate (umol/l): 0.086 - 0.339
  Silicate (umol/l): 1.103 - 4.465

Graphical representation

Depth range (m): 0.5 - 16

Temperature range (°C): 26.671 - 29.241

Nitrate (umol/L): 0.050 - 0.806

Salinity (PPS): 32.200 - 35.322

Oxygen (ml/l): 4.427 - 4.700

Phosphate (umol/l): 0.086 - 0.339

Silicate (umol/l): 1.103 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 5m.
From 1 to 5 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes lividus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTTTTTGGTGCCTGGGCCGGGATAGTAGGGACAGCTTTAAGCCTCCTCATTCGGGCAGAACTAAGCCAACCGGGCGCTCTCCTCGGAGACGACCAGATTTACAATGTTATTGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTTGGAAATTGACTTATTCCCTTAATAATTGGAGCCCCTGATATAGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTCCTCCCTCCATCATTTCTCCTTTTACTTGCTTCTTCAGGTGTTGAAGCAGGAGCAGGCACAGGGTGAACTGTATATCCTCCCCTCTCTGGTAACTTAGCTCACGCAGGAGCTTCCGTTGACCTAACTATCTTTTCTCTCCATCTAGCAGGGATCTCATCAATCCTGGGAGCAATTAACTTTATTACTACAATCATCAACATAAAACCACCTGCCATTTCCCAATATCAAACCCCTCTCTTCGTGTGAGCTGTTCTAATTACCGCTGTTCTACTCCTCCTCTCTCTCCCAGTACTAGCTGCCGGAATTACTATGCTTCTAACTGACCGAAACTTAAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCCATTCTCTATCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes lividus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!