Overview

Comprehensive Description

Biology

Usually found in flowing stretches of streams and medium-sized rivers with gravel to stone bottom, but also in a variety of other habitats, including sandy canals and lake shores. Larvae are benthic. Larvae and small juveniles prefer sand bottom and slow current, shifting to gravel bottom and fast current when growing. Preys on relatively large benthic invertebrates such as gammarids, chironomids, insect larvae. Breeds on gravel, sand or among aquatic vegetation. Tolerates moderate organic pollution and stream canalization and very sensitive to pollution by heavy metals (Ref. 59043). Sensitive to pollution and low oxygen levels, therefore, its presence in a river can be taken as an indication of good water quality (Ref. 6111).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Europe north of Caucasus, Pyrénées and Alps, from Loire and Rhône drainages eastward; British Isles (except northern Scotland), southern Sweden and Finland (northward to about 66°N); Danube and Vardar drainages. Several similar species in Asia, as far as Japan (including B. toni, which earlier was considered conspecific).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eurasia: Europe north of Caucasus, Pyrénées and Alps, from Loire and Rhone drainages eastward; British Isles ( except northern Scotland), southern Sweden and Finland (northward to about 66°N); northeastern Italy; Danube and Vardar drainages (Ref. 59043); Asia to China (Ref. 6111).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe and western Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 6 - 8; Analspines: 3; Analsoft rays: 5 - 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 210 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

21.0 cm TL (male/unsexed; (Ref. 1441)); max. published weight: 200 g (Ref. 5504); max. reported age: 7 years (Ref. 6111)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished from its congeners in Europe by the following combination of characters: caudal fin usually slightly emarginate (truncate in a few populations); pelvic origin beneath dorsal origin or under branched dorsal rays 1-2; caudal peduncle depth 1.4-2.2 (usually 1.6-2.0) times in its length, 1.2-1.8 times in body depth; often lacking dark blotches along back between nape and dorsal (Ref. 59043). Body elongated, anteriorly somewhat depressed, posteriorly laterally compressed. Three pairs of mouth barbels. No erectile spine below eye. Posterior margin of caudal fin slightly notched. Caudal fin with 15-17 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
Usually in flowing stretches of streams and medium-sized rivers with gravel to stone bottom, but also in a variety of other habitats, including sandy canals and lake shores. Spawns on gravel, sand or among aquatic vegetation. Larvae and small juveniles prefer sand bottom and slow current, shifting to gravel bottom and fast current when growing.

Biology:
Spawns for the first time usually at one year in central and southern Europe, 2-3 years in nutrient poor habitats and in northern Europe; most individuals spawn 1-2 seasons. Spawns in April-June at temperatures above 10°C, usually early morning. Open substrate, multiple spawner. Eggs are released in open water, often close to surface, drift and adhere to different substrates; they are often covered by sand or detritus. Individual females may spawn every day for a short period. Benthic larvae. Feeds on relative large benthic invertebrates (gammarids, chironomids, insect larvae). Tolerant to moderate organic pollution and stream canalisation, very sensitive to pollution by heavy metals.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; pH range: 7.0 - 7.7; dH range: 10 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns once a year for several years in low productivity streams, but exhibits multiple spawning within a season in high productivity environments (Ref. 40290, 40756). Releases eggs in open open water, often close to surface. Eggs drift and adhere to different substrates and are often covered by sand or detritus. Individual females may spawn daily for a short period (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Barbatula barbatula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTTGGTGCCTGAGCGGGCATAGTCGGAACTGCCCTAAGCCTATTAATCCGAGCCGAACTTAGTCAGCCAGGCTCCCTCCTTGGCGACGACCAAATCTACAACGTTATTGTCACCGCACATGCCTTTGTCATAATCTTCTTTATAGTAATGCCCATCCTCATCGGAGGTTTTGGTAACTGACTTGTACCACTAATGATTGGGGCCCCAGACATGGCGTTCCCCCGGATAAATAATATGAGCTTCTGACTCCTGCCACCCTCTTTTCTCTTACTACTGGCCTCATCCGGTGTTGAGGCAGGGGCAGGAACGGGGTGGACAGTATATCCTCCCCTTGCAGGCAACCTTGCCCACGCTGGGGCATCCGTTGACTTAACTATTTTTTCTTTACACCTAGCCGGGGCTTCATCTATTCTTGGGGCCATTAATTTTATTACGACTACAATTAATATGAAACCCCCAGCCATCTCCCAGTACCAAACCCCCCTTTTTGTGTGATCTGTCCTAGTAACTGCTGTCCTCCTGCTTCTATCCCTGCCCGTATTAGCCGCTGGGATCACAATGCTCCTCACAGACCGGAACCTAAACACTACGTTCTTCGACCCCTCGGGAGGAGGAGATCCCATCCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Barbatula barbatula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 118
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Barbatula barbatula toni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Freyhof, J.

Reviewer/s
Kottelat, M. & Smith, K.

Contributor/s
Kottelat, M.

Justification
A widespread species with no known major widespread threats.

European Union 27 = LC. Rationale same as above.

History
  • 2008
    Least Concern
    (IUCN 2008)
  • 2008
    Least Concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stone loach

For the stone loach family, see Nemacheilidae.

The stone loach, Barbatula barbatula, is a species of fresh water ray-finned fish in the Balitoridae family.

It is found in Baltic states, Eastern Europe, Austria, Belgium, Bulgaria, Czech Republic, Denmark, Finland, France, Germany, Hungary, Ireland, Italy, Liechtenstein, Luxembourg, Moldova, the Netherlands, Poland, Romania, Serbia and Montenegro, Slovakia, Spain, Sweden, Switzerland, and the United Kingdom.

Stone loaches live amongst the gravel and stones of fast flowing water where they can search for food. The most distinctive feature of this 14 cm fish is the presence of barbels around the bottom jaw, which they use to detect their invertebrate prey. The body is a mixture of brown, green and yellow.

Description[edit]

The stone loach is a small, slender bottom-dwelling fish growing to a length of about 14 cm (6 in). Its eyes are situated high on its head and it has three pairs of short barbels on its lower jaw below its mouth. It has a rounded body that is not much laterally flattened and is a little less deep in the body than the spined loach (Cobitis taenia) and lacks that fish's spines beneath the eye. It has rounded dorsal and caudal fins with their tips slightly notched, but the spined loach has even more rounded fins. The general colour of this fish is yellowish-brown with blotches and vertical bands of darker colour. An indistinct dark line runs from the snout to the eye. The fins are brownish with faint dark banding.[2]

Distribution and habitat[edit]

The stone loach is a common species and is found over most of Europe in suitable clear rivers and streams with gravel and sandy bottoms. It is present in upland areas, also chalk streams, lakes and reservoirs as long as the water is well-oxygenated. These fish sometimes venture into estuaries but not into brackish water. They live on the bottom, often partly buried, and they are particularly active at night when they rootle among the sand and gravel for the small invertebrates on which they feed.[2]

References[edit]

  1. ^ J. Freyhof & M. Kottelat (2008). "Barbatula barbatula". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 9, 2010. 
  2. ^ a b "Stone loach: Barbatula barbatula (L.)". NatureGate. Retrieved 2013-12-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!