Overview

Comprehensive Description

Biology

Inhabits oceanic surface waters. Capable of leaping out of the water and gliding for considerable distances above the surface (Ref. 3720). Eggs with bunch of filaments opposed by a single filament on opposite pole (Ref. 6523).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: flyingfish (English), volador (Espanol)
 
Hirundichthys rondeletii (Valenciennes, 1847)

Blackwing flyingfish


Elongate, broadly cylindrical bodies; head short, snout short and blunt; mouth small, jaws about equal in length; jaw teeth conspicuous, conical; sides of roof of mouth with teeth; fins without spines; 10-12 dorsal rays; 11-13 anal rays 1st  2 pectoral rays unbranched, fin reaches past anal base; dorsal fin usually with fewer or equal number of rays to anal; anal origin under or just behind dorsal origin; pelvic origin nearer anal origin than pectoral base, fin long, reaching past anal origin; tail deeply forked with a much longer lower lobe; lateral line low on the body, no branch to origin of pectoral; scales large, smooth, easily shed; 27-32 scales before dorsal fin; juveniles without barbels under chin.


Body dark iridescent blue above, silvery below; pectoral black, with narrow clear rear margin; dorsal and tail fins dusky, other fins clear; in juveniles the dorsal fin is clear with a dark outer blotch and the paired fins are black.

        Size: 32 cm.

Habitat: oceanic pelagic.

Depth: surface, 0-20 m.

        Circumsubtropical, off California to southern Baja, the Gulf of California to Chile; the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Mediterranean Sea and northeastern Atlantic (following Parin & Belyanina 2002:S33 [ref. 28438]); circumglobal according to other authors (in that case including Red Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Subtropical waters of all oceans. Eastern Atlantic: occasional to Spain and English Channel, western Mediterranean (a separate population migrates to the southeastern part in winter), Portugal to Mauritania and from south of Namibia; also off the Cape, South Africa (Ref. 2797). Western Atlantic: Massachusetts, USA and Bermuda to southern Brazil (Ref. 7251). Northwest Atlantic: Canada (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is circumsubtropical. In the eastern Pacific this species occurs from California to southern Baja California and in the southeastern Gulf of California. It also occurs off Panama, Cocos and the Galapagos and from Ecuador to southern Chile.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda to southern Brazil. Northern Gulf of Mexico, northern Bahamas
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Kuroshio Current, Kuroshio extension, transition zone (including Hawaiian Islands), and California Current.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 20 (G)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent, Island (s)

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 12; Analspines: 0; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 32.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body dark, iridescent blue above, silvery white below; dorsal and caudal fins greyish, other fins hyaline (Ref. 2797). Juveniles elongate, paired fins black (Ref. 2797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Exonautes gilberti Snyder, 1904
Catalog Number: USNM 50872
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Hawaii, Erben Bank To Kaiwi Channel, Hawaiian Islands, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 183
Vessel: Albatross
  • Type: Snyder, J. O. 1904. Bulletin of the United States Fish Commission. 22 (for 1902): 522, fig. 13, pl. 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is an oceanic pelagic species found to 5m. The species has a maximum size of 31cm in southern Chile (Vera and Pequeno, 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits oceanic surface waters. Capable of leaping out of the water and gliding for considerable distances above the surface.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 35 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0 - 4298
  Temperature range (°C): 2.258 - 27.353
  Nitrate (umol/L): 0.133 - 20.321
  Salinity (PPS): 33.660 - 37.967
  Oxygen (ml/l): 3.594 - 6.395
  Phosphate (umol/l): 0.038 - 1.343
  Silicate (umol/l): 0.886 - 34.597

Graphical representation

Depth range (m): 0 - 4298

Temperature range (°C): 2.258 - 27.353

Nitrate (umol/L): 0.133 - 20.321

Salinity (PPS): 33.660 - 37.967

Oxygen (ml/l): 3.594 - 6.395

Phosphate (umol/l): 0.038 - 1.343

Silicate (umol/l): 0.886 - 34.597
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Planktivore

Diet: zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hirundichthys rondeletii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCAGGAATAGTAGGGACCGCCCTAAGCCTTCTTATTCGAGCAGAACTAAGCCAACCCGGCTCTCTCCTTGGAGACGACCAAATTTATAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGTGGCTTTGGAAACTGACTCGTACCCCTCATGATCGGAGCCCCCGACATGGCATTCCCTCGAATAAATAATATGAGCTTTTGACTTCTCCCACCCTCTTTCCTTCTACTCCTAGCCTCTTCAGGAGTTGAAGCTGGAGCTGGGACAGGATGAACAGTGTACCCCCCTCTAGCAGGAAACCTAGCCCACGCTGGGGCATCCGTTGACCTAACAATTTTTTCGCTCCATCTAGCAGGAATTTCATCAATTCTAGGGGCAATTAACTTTATCACAACAATTATTAACATAAAACCTCCTGCAATTTCGCAGTACCAGACTCCGCTTTTCGTATGAGCAGTCCTTATTACAGCAGTTCTTCTACTCCTTTCCCTGCCCGTTCTTGCAGCAGGTATCACTATACTTCTAACAGACCGAAATCTAAACACAACATTCTTTGACCCTGCTGGAGGAGGTGATCCAATTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hirundichthys rondeletii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Collette, B., Carpenter, K., Meliane, I.

Reviewer/s
Polidoro, B, Livingstone, S. (Global Marine Species Assessment Team)

Justification
This species is widely distributed with in the eastern Pacific and there are no known threats. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species' distribution includes a number of Marine Protected Areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!