Overview
Comprehensive Description
Biology
Epipelagic to mesopelagic; at surface at night (Ref. 31442). Oviparous, with planktonic eggs and larvae (Ref. 31442).
-
Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)
http://www.fishbase.org/references/FBRefSummary.php?id=9325&speccode=50707
Trusted
Distribution
Eastern Pacific: region between 32°N and 22°S (Ref. 31442), including Chile (Ref. 9068).
-
Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)
http://www.fishbase.org/references/FBRefSummary.php?id=9325&speccode=50707
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 12; Analspines: 0; Analsoft rays: 17 - 20; Vertebrae: 38 - 41
-
Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707
Trusted
Size
Diagnostic Description
Branchiostegal rays: 8-9 (Ref. 31442).
-
Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707
Trusted
Ecology
Habitat
Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 20 - 700
Temperature range (°C): 5.741 - 26.896
Nitrate (umol/L): 0.229 - 40.570
Salinity (PPS): 34.217 - 34.814
Oxygen (ml/l): 0.143 - 4.969
Phosphate (umol/l): 0.245 - 3.219
Silicate (umol/l): 1.174 - 85.303
Graphical representation
Depth range (m): 20 - 700
Temperature range (°C): 5.741 - 26.896
Nitrate (umol/L): 0.229 - 40.570
Salinity (PPS): 34.217 - 34.814
Oxygen (ml/l): 0.143 - 4.969
Phosphate (umol/l): 0.245 - 3.219
Silicate (umol/l): 1.174 - 85.303
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 20 - 700
Temperature range (°C): 5.741 - 26.896
Nitrate (umol/L): 0.229 - 40.570
Salinity (PPS): 34.217 - 34.814
Oxygen (ml/l): 0.143 - 4.969
Phosphate (umol/l): 0.245 - 3.219
Silicate (umol/l): 1.174 - 85.303
Graphical representation
Depth range (m): 20 - 700
Temperature range (°C): 5.741 - 26.896
Nitrate (umol/L): 0.229 - 40.570
Salinity (PPS): 34.217 - 34.814
Oxygen (ml/l): 0.143 - 4.969
Phosphate (umol/l): 0.245 - 3.219
Silicate (umol/l): 1.174 - 85.303
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Life History and Behavior
Life Cycle
Oviparous (Ref. 31442).
-
Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gonichthys tenuiculus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTTTACCTAATCTTTGGTGCCTGGGCAGGTATAGTAGGAACTGCCCTCAGCCTTCTTATTCGAGCTGAACTAAGCCAGCCCGGAGCGCTTCTTGGCGATGACCAAATTTATAACGTAATCGTTACAGCTCACGCTTTCGTTATAATTTTCTTTATAGTTATGCCTATTATAATCGGCGGCTTTGGTAACTGATTAATTCCCTTAATAATCGGAGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGCTTCTGACTGCTGCCCCCGTCCTTCCTTCTTCTCTTAGCCTCCTCAGGTGTTGAAGCTGGAGCCGGAACTGGCTGAACAGTCTACCCGCCCCTTGCCGGAAATCTCGCCCACGCCGGGGCCTCCGTTGACTTAACAATTTTTTCTCTACACTTAGCAGGTGTGTCTTCTATTCTTGGAGCCATCAATTTTATTACCACTATTATTAATATAAAACCCCCTGCAATCTCTCAGTACCAAACCCCTCTGTTCGTTTGAGCTGTTTTAATTACAGCCGTCCTCCTATTACTTTCTCTGCCTGTACTAGCTGCCGGCATCACAATACTCCTAACAGACCGAAATCTTAACACCACTTTCTTTGACCCTGCAGGCGGCGGTGACCCAATTCTTTACCAACATCTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Gonichthys tenuiculus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


