Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Presumably schooling occurring mostly (or always ?) close inshore and entering bays and estuaries. Recorded at a temperature range of 26.0-29.0 °C in the Trinity Inlet system, Australia (Ref. 4959). Feeds mainly on crustaceans (zoea larvae, amphipods, Acetes). More data needed, including some functional explanation for the extraordinarily long maxillae. May be caught using ringnets (Ref. 5213). Used as bait in the tuna fishery in the South Pacific.
  • Munroe, T.A. and M. Nizinski 1999 Engraulidae. Anchovies. p. 1698-1706. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9822)   http://www.fishbase.org/references/FBRefSummary.php?id=9822&speccode=605 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Gulf of Oman south to Port Alfred, no records from the Red Sea and Madagascar; coasts of Pakistan, India, probably Burma; Thailand, Indonesia, Philippines to Taiwan; also the Arafura Sea (Ref. 9819), northern Australia, Papua New Guinea, Solomon Islands and New Hebrides.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East and South Africa east to Philippines and Vanuatu, north to Taiwan, south to North-West Cape (Western Australia) and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 180 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

18.0 cm SL (male/unsexed; (Ref. 9822))
  • Munroe, T.A. and M. Nizinski 1999 Engraulidae. Anchovies. p. 1698-1706. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9822)   http://www.fishbase.org/references/FBRefSummary.php?id=9822&speccode=605 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Presumably schooling occurring mostly (or always ?) close inshore and entering bays and estuaries. Recorded at a temperature range of 26.0-29.0 °C in the Trinity Inlet system, Australia (Ref. 4959). Feeds mainly on crustaceans (zoae larvae, amphipods, @Acetes@). More data needed, including some functional explanation for the extraordinarily long maxillae. May be caught using ringnets (Ref. 5213). Used as bait in the tuna fishery in the South Pacific.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belly with 25 to 28 keeled scutes. Distinguished from all other Thryssa species and anchovies by the very long maxilla, reaching at least to tip of pectoral fin, usually to pelvic fin base or even to anal fin origin; also unique is the high coronoid process of the lower jaw, the jaw rising steeply in the mouth. Head with gold tints; anal and caudal fins deep yellow; dark spot behind gills.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; brackish; marine; depth range 1 - 20 m (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 1 - 100
  Temperature range (°C): 25.679 - 28.013
  Nitrate (umol/L): 0.088 - 2.179
  Salinity (PPS): 34.233 - 35.835
  Oxygen (ml/l): 4.168 - 4.772
  Phosphate (umol/l): 0.085 - 0.412
  Silicate (umol/l): 1.158 - 7.567

Graphical representation

Depth range (m): 1 - 100

Temperature range (°C): 25.679 - 28.013

Nitrate (umol/L): 0.088 - 2.179

Salinity (PPS): 34.233 - 35.835

Oxygen (ml/l): 4.168 - 4.772

Phosphate (umol/l): 0.085 - 0.412

Silicate (umol/l): 1.158 - 7.567
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 13m.
From 10 to 13 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Presumably schooling, mostly (or always ?) close inshore, entering bays and estuaries (Ref. 189, 75154). Inhabits coral reefs (Ref. 58534). More data needed including some functional explanation for the extraordinarily long maxillae (Ref. 189).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thryssa setirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Thryssa setirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTGGTATTCGGTGCCTGAGCAGGCATGGTGGGAACAGCGCTAAGCCTCTTAATTCGAGCAGAACTAAGCCAACCAGGAGCACTTTTAGGGGATGATCAAATTTACAATGTCATCGTAACCGCTCATGCTTTCGTAATAATCTTTTTCATAGTAATGCCCATCCTAATTGGGGGTTTTGGAAACTGATTAGTGCCCCTTATACTAGGAGCACCCGATATGGCGTTCCCACGAATGAATAATATAAGCTTCTGACTTCTCCCCCCCTCATTTCTTCTTTTGCTGGCCTCGTCTGGGGTCGAAGCGGGGGCAGGAACCGGATGAACAGTGTATCCCCCTCTAGCGGGAAATCTAGCCCATGCAGGAGCATCAGTAGATCTTACTATTTTCTCCCTCCACCTGGCAGGGATCTCATCTATTCTAGGAGCAATTAACTTCATTACTACAATCATCAACATGAAACCACCTGCAATCTCACAATACCAAACGCCACTCTTCGTCTGAGCTGTACTTATTACAGCAGTACTTTTACTCCTTTCTCTCCCAGTGCTGGCTGCGGGCATTACAATGCTTCTTACAGACCGAAATCTTAACACCACCTTCTTCGACCCCGCAGGAGGAGGTGACCCAATCCTCTATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thryssa setirostris sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; bait: usually; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!