Overview

Comprehensive Description

Biology

Spawning adults are found in gravel riffles and runs of clear coastal streams; feeding adults usually in the ocean, but landlocked populations occur (Ref. 1998); ammocoetes in silt, mud, and sand of shallow eddies and backwaters of streams (Ref. 5723). Parasitic adults attach themselves to the side or undersurface of its prey, from which it draws blood and body fluids as food. Preys on fishes and sperm whales (Ref. 6885). Stops feeding once upstream spawning migration is underway (Ref. 1998). Rarely consumed as food; prepared fresh or smoked (Ref. 6885). Sometimes processed into meal (Ref. 27436). The effects of Pacific lamprey attacks on commercial species needs further studies (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Bering Sea coasts of Asia and Alaska southward to the Yuhutu River, Hokkaido, northern Japan and Punta Canoas, central Baja California, Mexico. The populations were, at one time, split into two groups (Ref. 10015) as Entosphenus tridentatus tridentatus which ranged from the Columbia River to Alaska, and Entosphenus tridentatus ciliatus which ranged from Klamath River southwards (Ref. 1998). This division no longer holds (Ref. 1998). Freshwater resident populations exist in Culrus Lake and the Columbia River, British Columbia, the Sprague River in Oregon, the Goose Lake in Oregon/California, and the Klamath and Shasta rivers and Copco Lake in California (Ref. 12269).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Pacific lampreys occur in rivers of the Pacific Coast from Alaska (apparently rare north of the Alaska Peninsula) to the Rio Santo Domingo in Baja California (Malibu Creek, Los Angeles County, seems to be the southernmost point of regular occurrence in California; scattered distribution south of San Luis Obispo County, with regular runs in the Santa Clara River) (Moyle 2002). Adults are wide-ranging in the Pacific Ocean from Japan to Baja California. Along the Pacific coast of Japan they have been found as far south as the Yuhutu River, Hokkaido, but the species is not known to spwan there (Scott and Crossman 1973, Lee et al. 1980, Page and Burr 1991, Wydoski and Whitney 2003). Landlocked parasitic populations are known from Goose Lake and its tributaries in Oregon and California; Upper Klamath Lake, Oregon (reported as upper Klamath River by Moyle 2002); Cottonwood Reservoir in Lake County, Oregon; Cowichan Lake and River, British Columbia (this population is now included in L. macrostoma); and apparently in Dworshak Reservoir on the North Fork of the Clearwater River in Idaho (not lamprey collected there since 1973) (Scott and Crossman 1973, Moyle et al. 1995, Wydoski and Whitney 2003). A recently (1963) landlocked population exists in Clair Engle Reservoir on the Trinity River, Trinity County, California (Moyle 2002).

In Washington, the species ranges long distances upstream in the Columbia, Snake, and Yakima river systems (Wydoski and Whitney 2003). Historically, the Pacific lamprey occurred as far upstream as Kettle Falls in the Columbia River and Spokane Falls on the Spokane River (Wydoski and Whitney 2003). Grand Coulee Dam, completed in 1941, and Chief Joseph Dam, completed in 1955, blocked upstream passage on the Columbia River. Today, the lamprey occurs upstream to the Hells Canyon Dam on the Snakes River (Wydoski and Whitney 2003). In California, Pacific lampreys are blocked by major barriers, such as Friant Dam on the San Joaquin River and Scott Dam on the Eel River (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 500 g (Ref. 27436); max. reported age: 9 years (Ref. 72464)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 76 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Characterized by the presence of 3 (rarely 2) large sharp teeth on the supraoral bar and three sharp points on each of the central lateral tooth plates (Ref. 27547). Dorsal fins arise far back on the body, the anterior fin lower and shorter, higher in males; lower lobe of caudal fin larger than upper, the lobes joined to dorsal and anal fins; anal fin rudimentary, virtually absent in males (Ref. 27547). Adults from the sea blue-black to greenish above, silvery to white below; spawning adults become reddish brown (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Lampetra tridentata
Catalog Number: USNM 978
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Trowbridge
Locality: Astoria or., Oregon, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Lampetra tridentata
Catalog Number: USNM 976
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Williamson
Locality: Williamette R., Oregon, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Columbia River Demersal Habitat

This taxon is one of a number of demersal species in the Columbia River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality in the Columbia River has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Some large demersal fish species occurring in the Columbia Basin are the 610 centimeter (cm) white sturgeon (Acipenser transmontanus), the 76 cm Pacific lamprey (Lampetra tridentata); the 55 cm Brown bullhead (Ameiurus nebolosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 1100 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Columbia River habitat

The Columbia River Basin of northwestern North America is an important habitat for the 76 cm Pacific lamprey (Lampetra tridentata) The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Other large demersal vertebrate species occurring in the Columbia Basin are the 55 cm Brown bullhead (Ameiurus nebulosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens). Other large benthopelagic fish in the Columbia are the 63 cm northern pikeminnow (Ptychocheilus oregonensis) and the 45 cm Tui chub (Gila bicolor).

  • C.Michael Hogan. 2012. Columbia River. Eds. P.Saundry & C.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC www.eoearth.org/article/Columbia_River?topic=78166
  • Fishbase. 2010. Fish species in the Columbia River Basin
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 20 - 181.5
  Temperature range (°C): 7.150 - 8.018
  Nitrate (umol/L): 23.221 - 27.924
  Salinity (PPS): 33.409 - 33.799
  Oxygen (ml/l): 2.801 - 3.625
  Phosphate (umol/l): 1.970 - 2.300
  Silicate (umol/l): 34.412 - 43.852

Graphical representation

Depth range (m): 20 - 181.5

Temperature range (°C): 7.150 - 8.018

Nitrate (umol/L): 23.221 - 27.924

Salinity (PPS): 33.409 - 33.799

Oxygen (ml/l): 2.801 - 3.625

Phosphate (umol/l): 1.970 - 2.300

Silicate (umol/l): 34.412 - 43.852
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Ammocoetes inhabit shallow backwater and eddy areas along edges of streams in mud, silt and sand (Lee et al. 1980). In southern California, adults apparently spend approximately one year in fresh water prior to spawning (Chase 2001). Adults spawn in runs and riffles in rock-, sand-, or gravel-bottomed clear streams, in shallow depressions, or crude nests, 2 inches deep and 4-5 inches in diameter, at the heads of riffles (Wydoski and Whitney 1979). Lake populations in British Columbia spawn at creek mouths, sometimes move up to a few 100 m up creek (Beamish 1987). Goose Lake, California, population spawns in gravel riffles of tributary streams, far enough upstream such that there is adequate ammocoete habitat (muddy backwaters) downstream from the breeding area (Moyle et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Mainly anadromous; newly metamorphosed individuals migrate from parent stream to Pacific Ocean. In the Sanata Clara River in southern California, upstream migration began as early as mid-December or as late as mid-March; peak migration occurred in March in most years (Chase 2001). Goose Lake, California, population migrates up to 20-30 km between lake and tributary streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Spawning adults are found in gravel riffles and runs of clear coastal streams; feeding adults usually in the ocean, but landlocked populations occur (Ref. 1998); ammocoetes in silt, mud, and sand of shallow eddies and backwaters of streams (Ref. 5723). Some individuals may spend up to 42 mo. in saltwater before returning to freshwater (Ref. 12479).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults parasitic on fishes; attach and feed on body fluids. Parasitic stage may last 20-40 months (Lee et al. 1980) (probably 1-2 years in Goose Lake, California, population: Moyle et al. 1989). Ammocoetes (larvae) are filter feeders; feed on microscopic plant and animal material.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is not available from Asia, and occurrences are not tracked in North America. Therefore, the number of occurrences can only be estimated based on collection maps and natural heritage programs state and provincial ranks. Lee et al. (1980) and the Texas Natural History Collection Index to North American Freshwater Fishes (1998) mapped approximately 110 collection sites. Heritage program ranks of apparently secure and secure in California, British Columbia, Alaska, and Washington suggest a large number of occurrences (probably more than 100).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Information on abundance is limited to an estimate in a British Columbia river (Beamish and Levings 1991) and spotty counts of ammocoetes at fish screen traps and adults during spawning migrations at dams (Weeks 1991, 1993). Migration of young adults out of the Nicola River (Fraser River System, British Columbia) from 1984-1988 was estimated to be approximately 176,000, 19,000, 90,000, and 102,000; at the same time, approximately 749,000, 909,000, 920,000, and 650,000 large ammocoetes, age four to five years, left the river. This indicates the species is abundant in the Fraser River (Beamish and Levings 1991). Counts of ammocoetes conducted by the Army Corps of Engineers at Little Goose Dam, Oregon from 1983-1989 ranged from 19,000 to 65,000 individuals. These numbers are small compared to counts from the 1960s (Weeks 1993). Experimental counts of adults at Bonneville Dam on the Columbia River, Oregon, from 1987-1989 yielded 200, 817, and 6 individuals, respectively (Weeks 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Adults die soon after spawning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

In the spring following the migration into fresh water, a male and a female dig a nest. In the spawning act, the female attaches herself to a rock and the male fastens its sucker on the head of the female and coils around the female. The two then vibrate and eggs and sperms are released (Ref. 27547). Males spawn with more than one female in different nests (Ref. 1998). Adults die 1-14 days after spawning (Ref. 1998). Larvae remain buried in the stream bottom for up to 5 or 6 years and return to the sea after changing into the adult form (Ref. 1998). The parasitic adults spend 12-20 months in the sea before moving upstream to spawn (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

According to Wydoski and Whitney (1979) spawning occurs in June-July in Washington. In southern California, spawning likely begins by late January in most years, and spawning may continue into April (Chase 2001). Eggs hatch in 2 or 3 weeks. Ammocoetes remain in stream, metamorphose in 4-6 years (late September-October). Form macrostoma in British Columbia: spawns May-August, probably spends 6 years as larva and 2 years as subadult-adult before reproducing; metamorphosis July-October (Beamish 1987). This is the only species of lamprey in which some individuals (from Washington) are known to spawn more than once (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Entosphenus tridentatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATCTTCGGGGCCTGAGCAGGAATAGTGGGAACCGCTTTAAGTATTCTTATTCGAGCAGAACTAAGTCAACCAGGCACTTTACTAGGAGATGACCAAATTTTTAACGTTATCGTAACCGCCCATGCTTTCGTTATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGCTTCGGAAACTGACTTGTACCACTCATACTTAGTGCCCCTGATATAGCCTTCCCTCGTATAAACAACATAAGCTTTTGATTACTTCCACCCTCACTACTCCTACTTTTAGCCTCCGCAGGAGTTGAAGCAGGGGCTGGCACAGGATGAACCGTATACCCACCTCTAGCAGGAAACTTAGCCCACACAGGGGCCTCCGTTGACTTAACAATTTTCTCCCTACATTTAGCCGGAATTTCATCAATTCTAGGAGCAGTCAACTTTATTACAACAATCTTCAATATAAAACCCCCAACTATAACACAATATCAAACTCCTTTATTTGTTTGATCTGTTTTAATTACCGCAGTACTTCTTCTTCTATCACTTCCTGTACTTGCAGCCGCCATCACTATACTTTTAACAGATCGCAATTTAAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Entosphenus tridentatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread distribution around the margins of the northern Pacific Ocean; specific occurrence data are limited, but evidently there are many occurrences in North America; declines have occurred in some areas, but appears to be very abundant in other locations; threatened by dams and habitat degradation.

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Short-term trends are difficult to interpret because lampreys perhaps may produce stronger year-classes in some years than in others (spawning may not occur in all small streams every year; or perhaps ammocoetes from one spawning may transform to adults over a period of years) (Wydoski and Whitney 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B?

Comments: Lampreys are vulnerable to habitat losses due to reduced river flows, water diversions, dredging, streambed scouring, channelization, inadequate protection of stream side vegetation, chemical pollution, and impeded upstream passage due to dams and poorly designed road culverts (Center for Biodiversity).

Hydropower development, habitat alterations, and land management practices (e.g., irrigation) are thought to be responsible for the declines in the Columbia and Snake rivers (Claire and Cochnauer). Many declines are probably the result of obstructions (i.e., dams) that prevent spawning migration of adults and cause habitat degradation of spawning and larval rearing areas (Weeks 1991). Pacific lampreys were formerly common in the Snake, Clearwater, and Salmon river drainages in Idaho, but dams have had an adverse impact on their migration up the Snake River (Wydoski and Whitney 2003). The population in Elsie Lake in British Columbia was apparently extirpated approximately seven years after dams were constructed on the lake's outlet (Beamish and Northcote 1989). The Goose Lake, California, population may be negatively affected by dams and other obstructions that prevent adults from reaching spawning areas and by stream channelization, grazing, and diversions of water for irrigation, which may cause ammocoete habitat to dry up or become unsuitable (Moyle et al. 1989 and 1995).

Severe declines in salmon abundance may also be influential in the lamprey decline because salmon are one of the primary food resources (Wydoski and Whitney 2003).

Pacific lampreys were historically used extensively for food, trade, ceremonial, and medicinal purposes by Indian tribes in Oregon and British Columbia (Scott and Crossman 1973, Weeks 1991). In the 1940s, they were commercially harvested at Willamette Falls on the Willamette River, Oregon. Harvests averaged 300,000 pounds annually and were used to produce a chemical to aid in blood coagulation. Currently, commercial harvest at Willamette Falls ranges from 3,000 to 11,000 pounds annually and is sold as bait or to biological supply houses. Commercial harvest is now prohibited in some areas in Oregon. However, Indian tribes still harvest lamprey for personal use. At Willamette Falls, native harvests are probably comparable to the present level of commercial harvest. In Oregon, native harvests now occur primarily at Bonneville Dam and to a lesser extent at Sherar Falls on the Deschutes River and Willamette Falls, on the Willamette River.

A 1990 spill of hydrochloric acid in John Day River, Oregon, resulted in the death of an estimated 10,000 ammocoetes (Weeks 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Research Needs: Determine the taxonomic status of the various landlocked populations (Moyle 2002).

Biological Research Needs: Better information is needed on threats and the degree of threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: No known protected sites. The Goose Lake population is listed as threatened in California (Moyle et al. 1995). The state of Oregon listed the Pacific lamprey as a sensitive species in 1993 and followed with protected status in 1996 (Kostow 2002).

Needs: Goose Lake (California) population: improving access and flows in streams, especially Lassen and Willow creeks, would be beneficial to this species and to Goose Lake redband trout (Moyle et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Pacific lampreys seem to have little effect on fish populations, and they are of ecological value as prey for pinnipeds and of economic/cultural value as food for humans (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pacific lamprey

The Pacific lamprey (Entosphenus tridentatus) is an anadromous parasitic lamprey from the Pacific Coast of North America and Asia. It is also known as the three tooth lamprey and tridentate lamprey.

Biology [edit]

Lampetra tridentata.jpg

Pacific lamprey are dark blue or brown in color and grow to about 30 inches (76 cm) as adults. They are anadromous (meaning they are born in fresh water, swim out to the ocean where they feed as a juvenile, and then mature and return to freshwater as an adult to reproduce). Pacific lampreys are semelparous (meaning they die after reproducing once during their lifetime). Although the adult and juvenile stages are more noticeable, lamprey spend the majority of their lives as larvae (ammocoetes). Ammocoetes live in fresh water for many years (usually 3-7 years, but at least one species has been recorded for +17 years). Ammocoetes are filter feeders who draw overlying water into burrows they dig into soft bottom substrates. After the larval period the ammocoetes undergo metamorphosis and take on the juvenile/adult body morphology. Juveniles/adults have a jawless sucker-like mouth that allows them to become parasitic on other fish. The adults live at least 1-2 years in the ocean and then return to fresh water to spawn. It is not well understood if Pacific lamprey return to their natal streams or seek spawning areas based on other cues. They typically spawn in similar habitat to Pacific salmon and trout. Lamprey construct a nest (redd) in small gravel and females can lay over 100,000 eggs, which are fertilized externally by the male. After spawning the adults usually die within 4 days. Also, like salmon, the Pacific lamprey does not feed while migrating to spawn.

As Food [edit]

Pacific lamprey are an important ceremonial food for Native American tribes in the Columbia River basin. Pacific lamprey numbers in the Columbia River have greatly declined with the construction of the Columbia River hydro-power system. Almost no harvest opportunity for Native Americans remains in the Columbia River and its tributaries except for a small annual harvest at Willamette Falls on the Willamette River (tributary to the Columbia River).

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The Goose Lake population of L. tridentata, presumably derived from sea-run populations from the Klamath drainage, likely deserves recognition as a distinct subspecies (Moyle et al. 1989, Moyle 2002). Populations in Lake Cowichan and Mesachie Lake, British Columbia, formerly included in L. tridentata, are now regarded as a distinct species, L. macrostoma (Beamish 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!