Overview

Comprehensive Description

Biology

Anadromous, but also a number of permanent freshwater resident populations (Cultus Lake, British Columbia; Sprague River, Klamath River Basin, Oregon). In marine waters, adults mostly inhabit the mesopelagic zone down to 800 m depth and have been documented as far as 117 km off the coast of Oregon. In fresh waters, ammocoetes and adults inhabit lakes, rivers, and creeks. Ammocoetes occur in soft sediments in shallow areas along stream banks (Ref. 89241); in silt, mud, and sand of shallow eddies and backwaters of streams (Ref. 5723). Spawning adults are found in gravel riffles and runs of clear coastal streams; feeding adults usually in the ocean, but landlocked populations occur (Ref. 1998). Stops feeding once upstream spawning migration is underway (Ref. 1998). Parasitic adults attach themselves to the side or undersurface of its prey, from which it draws blood and body fluids as food. Preys on fishes and sperm whales (Ref. 6885). Adults are found in the Strait of Georgia from December to mid-June. The duration of the feeding phase at sea has been estimated at 20-42 months. In British Columbia, return to fresh water begins as early as April and is completed by September. In the Columbia River, prior to the completion of the Grand Coulee Dam in 1941, spawning migrations of 800 km up to Kettle Falls, Washington occurred. In order to cross barriers such as falls, they use their suctorial disc to attach to the vertical surfaces and slowly make their way up. In British Columbia spawning is in June to the end of July, while in Oregon, it begins in May at water temperatures of 10-15 °C and continues through July. Fecundity, 98,300-238,400 eggs/female in Oregon populations from Clear, Trout, and Cow creeks, respectively, in the John Day, Molalla, and Umpqua river basins. Death of spawners follows 3-36 days after spawning. Eggs are eaten by two species of fish in the Umatilla River, Oregon (Ref.89241). Rarely consumed as food; prepared fresh or smoked (Ref. 6885). Sometimes processed into meal (Ref. 27436). The Native American tribes of the mid-Columbia River Plateau have an ongoing tradition dating back hundreds of years of harvesting Pacific Lamprey. The adults are caught either by hand or dipnet in areas where they congregate prior to spawning. They are prepared for human consumption either by drying or roasting. Caloric values for Pacific Lamprey range from 5.9 to 6.3 kcal/g wet weight. Their oil is also extracted and used for medicinal purposes. Ammocoetes are used as bait for introduced Micropterus dolomieu in the John Day River, Oregon. In 1812, Americans of European descent obtained Pacific Lamprey from the Umatilla tribe of Oregon for the purposes of consumption. In the early 1900s, fur trappers utilized Pacific Lamprey as bait for coyotes. A fishery for adult lamprey has existed at Willamette Falls on the Willamette River, Oregon at least since 1913. That year, 24.5 metric tons were harvested and ground into fishmeal for young hatchery salmon. Between 1943 and 1949, 740 metric tons in total were harvested and used for vitamin oil, food for livestock, poultry, and fishmeal. In 1994, about 1.8 metric tons were exported to Europe for human consumption. The North Carolina Biological Supply House regularly collects adults from this locality for use as teaching material (Ref.89241). The effects of Pacific lamprey attacks on commercial species needs further studies (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Pacific lampreys occur in rivers around the North Pacific Ocean from Hokkaido, Japan (Yamazaki et al. 2005), to Alaska (Cape Lisburne and Norton Sound; apparently rare north of the Alaska Peninsula) and south to southern Baja California (Luzier et al. 2011). Malibu Creek, Los Angeles County, seems to be the southernmost point of regular occurrence in California; scattered distribution south of San Luis Obispo County, with regular runs in the Santa Clara River (Moyle 2002). Adults are wide-ranging in the Pacific Ocean from Japan to Baja California. Landlocked populations occur in lakes or reservoirs in British Columbia, Oregon, California, and possibly elsewhere.

At least historically, Pacific lampreys penetrated far inland in the Fraser, Columbia (to Idaho), Klamath-Trinity, Eel, and Sacramento-San Joaquin rivers. Dams now block or inhibit upstream passage in many rivers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Bering Sea coasts of Asia and Alaska southward to the Yuhutu River, Hokkaido, northern Japan and Punta Canoas, central Baja California, Mexico. The populations were, at one time, split into two groups (Ref. 10015) as Entosphenus tridentatus tridentatus which ranged from the Columbia River to Alaska, and Entosphenus tridentatus ciliatus which ranged from Klamath River southwards (Ref. 1998). This division no longer holds (Ref. 1998). Freshwater resident populations exist in Culrus Lake and the Columbia River, British Columbia, the Sprague River in Oregon, the Goose Lake in Oregon/California, and the Klamath and Shasta rivers and Copco Lake in California (Ref. 12269).
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 76 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 500 g (Ref. 27436); max. reported age: 9 years (Ref. 72464)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
  • Moyle, P.B. 1976 Inland fishes of California. University California Press. (Ref. 72464)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by the presence of 3 (rarely 2) large sharp teeth on the supraoral bar and three sharp points on each of the central lateral tooth plates. Dorsal fins arise far back on the body, the anterior fin lower and shorter, higher in males; lower lobe of caudal fin larger than upper, the lobes joined to dorsal and anal fins; anal fin rudimentary, virtually absent in males. Adults from the sea blue-black to greenish above, silvery to white below; spawning adults become reddish brown (Ref. 27547). Other diagnostic characters: oral disc as wide or wider than head; usually 64-71 trunk myomeres; dark blue or brown above, light or silver below (Ref. 86798). Adults: 9.6-80.0 cm TL. Specimens 38-62 cm TL weigh 120-510 g wet weight. Body proportions, as percentage of TL (based on 274 specimens measuring 9.6-71.6 cm TL): prebranchial length, 9.8-18.0; branchial length, 7.8-12.6; trunk length, 40.3-54.0; tail length, 23.6-34.9; eye length, 1.3-4.5; disc length, 4.6-9.1. The urogenital papilla length, as a percentage of branchial length, in two spawning males measuring 21.1-21.7 cm TL, 12.0-12.5. Trunk myomeres, 60-71 (may be as low as 57 and as high as 78). Dentition: marginals, 48-62; supraoral lamina, 3 unicuspid teeth, the median one being smaller; infraoral lamina, 5-6 unicuspid teeth, predominantly 5; 4 endolaterals on each side; endolateral formula, typically 2-3-3-2, the first endolateral rarely unicuspid and the second and third endolaterals rarely bicuspid; 2 rows of anterials; first row of anterials, either 1 or 5 unicuspid teeth; exolaterals absent; 1 row of posterials, 12-21 teeth, of which 0-5 may be bicuspid and the remainder unicuspid; transverse lingual lamina, 14-23 unicuspid teeth, the median one slightly enlarged; longitudinal lingual laminae parentheses-shaped, each with 20-27 unicuspid teeth [50-63 according to McPhail and Lindsey (1970)]. Velar tentacles, 10-18, with tubercles; the dorsal wings may each consist of up to 5-6 long tentacles that reach the median tentacle. Median tentacle about the same length as the lateral ones immediately next to it. Four of five specimens from the Sprague River did not possess wings and had 7-10 tentacles. Body coloration (preserved), dorsal, lateral, and ventral aspects bluish gray in older individuals and ventral aspect either dark gray or almost white in recently metamorphosed individuals. Lateral line neuromasts unpigmented or darkly pigmented. Caudal fin pigmentation, +++. Caudal fin shape, rounded or spade-like. Oral fimbriae, 94-105. Oral papillae, 12-18 (Ref. 89241).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Lampetra tridentata
Catalog Number: USNM 978
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Trowbridge
Locality: Astoria or., Oregon, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Lampetra tridentata
Catalog Number: USNM 976
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Williamson
Locality: Williamette R., Oregon, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Columbia River Demersal Habitat

This taxon is one of a number of demersal species in the Columbia River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality in the Columbia River has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Some large demersal fish species occurring in the Columbia Basin are the 610 centimeter (cm) white sturgeon (Acipenser transmontanus), the 76 cm Pacific lamprey (Lampetra tridentata); the 55 cm Brown bullhead (Ameiurus nebolosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 1508 m (Ref. 96339)
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: The predatory phase of the life cycle (excluding land-locked populations) occurs in the ocean, primarily near stream mouths in estuaries and in other coastal areas but sometimes far away (Moyle 2002). Freshwater-resident populations exist in several areas in British Columbia (McPhail 2007) and elsewhere.

Ammocoetes inhabit shallow backwater and eddy areas along edges of streams in mud, silt and sand (Lee et al. 1980). In southern California, adults apparently spend approximately one year in fresh water prior to spawning (Chase 2001).

Adults spawn in runs and riffles in rock-, sand-, or gravel-bottomed clear streams, in small, shallow depressions, or crude nests, at the heads of riffles (Wydoski and Whitney 1979). Water depth at spawning sites often is 30-150 cm (Moyle 2002).

Lake populations in British Columbia spawn at creek mouths or sometimes move up to a few hundred meters up creeks (Beamish 1987). The Goose Lake, California, population spawns in gravel riffles of tributary streams, far enough upstream such that there is adequate ammocoete habitat (muddy backwaters) downstream from the breeding area (Moyle et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columbia River habitat

The Columbia River Basin of northwestern North America is an important habitat for the 76 cm Pacific lamprey (Lampetra tridentata) The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Other large demersal vertebrate species occurring in the Columbia Basin are the 55 cm Brown bullhead (Ameiurus nebulosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens). Other large benthopelagic fish in the Columbia are the 63 cm northern pikeminnow (Ptychocheilus oregonensis) and the 45 cm Tui chub (Gila bicolor).

  • C.Michael Hogan. 2012. Columbia River. Eds. P.Saundry & C.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC www.eoearth.org/article/Columbia_River?topic=78166
  • Fishbase. 2010. Fish species in the Columbia River Basin
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 20 - 181.5
  Temperature range (°C): 7.150 - 8.018
  Nitrate (umol/L): 23.221 - 27.924
  Salinity (PPS): 33.409 - 33.799
  Oxygen (ml/l): 2.801 - 3.625
  Phosphate (umol/l): 1.970 - 2.300
  Silicate (umol/l): 34.412 - 43.852

Graphical representation

Depth range (m): 20 - 181.5

Temperature range (°C): 7.150 - 8.018

Nitrate (umol/L): 23.221 - 27.924

Salinity (PPS): 33.409 - 33.799

Oxygen (ml/l): 2.801 - 3.625

Phosphate (umol/l): 1.970 - 2.300

Silicate (umol/l): 34.412 - 43.852
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

This species is mainly anadromous; newly metamorphosed individuals migrate from parent streams to the Pacific Ocean. Upstream migrations may be as long as several hundred kilometers. Land-locked populations omit the oceanic phase but migrate between lakes and spawning streams. Goose Lake, California, population migrates up to 20-30 km between the lake and tributary streams. See reproduction comments for further information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Spawning adults are found in gravel riffles and runs of clear coastal streams; feeding adults usually in the ocean, but landlocked populations occur (Ref. 1998); ammocoetes in silt, mud, and sand of shallow eddies and backwaters of streams (Ref. 5723). Some individuals may spend up to 42 mo. in saltwater before returning to freshwater (Ref. 12479).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Adults parasitic on fishes; attach and feed on body fluids. Parasitic stage may last 20-40 months (Lee et al. 1980) (probably 1-2 years in Goose Lake, California, population: Moyle et al. 1989). Ammocoetes (larvae) are filter feeders; feed on microscopic plant and animal material.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of subpopulations, but many of these are much reduced and of low viability.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large. This species is common in small and large rivers along the entire coast of British Columbia (McPhail 2007).

Migration of young adults out of the Nicola River (Fraser River System, British Columbia) from 1984-1988 was estimated to be approximately 176,000, 19,000, 90,000, and 102,000; at the same time, approximately 749,000, 909,000, 920,000, and 650,000 large ammocoetes, age four to five years, left the river. This indicates the species is abundant in the Fraser River (Beamish and Levings 1991). See Luzier et al. (2011) for population estimates for various U.S. river systems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Adults die soon after spawning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

In the spring following the migration into fresh water, a male and a female dig a nest. In the spawning act, the female attaches herself to a rock and the male fastens its sucker on the head of the female and coils around the female. The two then vibrate and eggs and sperms are released (Ref. 27547). Males spawn with more than one female in different nests (Ref. 1998). Adults die 1-14 days after spawning (Ref. 1998). Larvae remain buried in the stream bottom for up to 5 or 6 years and return to the sea after changing into the adult form (Ref. 1998). The parasitic adults spend 12-20 months in the sea before moving upstream to spawn (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The timing of migration to spawning stream varies geographically, and different runs may occur in a single river system. According to Wydoski and Whitney (1979) spawning occurs in June-July in Washington. In southern California, spawning likely begins by late January in most years, and spawning may continue into April (Chase 2001). In the Santa Clara River in southern California, upstream migration began as early as mid-December or as late as mid-March; peak migration occurred in March in most years (Chase 2001). Eggs hatch in 2 or 3 weeks. Ammocoetes remain in stream, metamorphose in 4-6 years (late September-October). Form macrostoma in British Columbia: spawns May-August, probably spends 6 years as larva and 2 years as subadult-adult before reproducing; metamorphosis July-October (Beamish 1987). Oceanic phase apparently may last 3-4 years in British Columbia but may be shorter in more southern areas (Moyle 2002). Generation time is 9 years (Luzier et al. 2011).

This is the only species of lamprey in which some individuals (from Washington) are known to spawn more than once (Page and Burr 1991).

See Luzier et al. (2011) for an up-to-date review of Pacific lamprey life history.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Entosphenus tridentatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATCTTCGGGGCCTGAGCAGGAATAGTGGGAACCGCTTTAAGTATTCTTATTCGAGCAGAACTAAGTCAACCAGGCACTTTACTAGGAGATGACCAAATTTTTAACGTTATCGTAACCGCCCATGCTTTCGTTATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGCTTCGGAAACTGACTTGTACCACTCATACTTAGTGCCCCTGATATAGCCTTCCCTCGTATAAACAACATAAGCTTTTGATTACTTCCACCCTCACTACTCCTACTTTTAGCCTCCGCAGGAGTTGAAGCAGGGGCTGGCACAGGATGAACCGTATACCCACCTCTAGCAGGAAACTTAGCCCACACAGGGGCCTCCGTTGACTTAACAATTTTCTCCCTACATTTAGCCGGAATTTCATCAATTCTAGGAGCAGTCAACTTTATTACAACAATCTTCAATATAAAACCCCCAACTATAACACAATATCAAACTCCTTTATTTGTTTGATCTGTTTTAATTACCGCAGTACTTCTTCTTCTATCACTTCCTGTACTTGCAGCCGCCATCACTATACTTTTAACAGATCGCAATTTAAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Entosphenus tridentatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Distribution and abundance have declined greatly in much of the range (especially in Washington, Oregon, Idaho, and California), but the species remains widespread with many subpopulations around the margins of the northern Pacific Ocean, in much of the U.S. range, species is threatened by barriers on mainstem and tributary streams, streamflow management, stream and floodplain degradation, and reduced water quality. NatureServe's rank calculator version 3.1 yielded a rank of G3G4 or G4, depending on the estimated degree of decline.and estimated threat impact. Given the apparently secure status in British Columbia (a large area and significant portion of the range), and apparently low degree of threat and occurrence in many streams in Alaska (although status there is not well known), this species is ranked G4.

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-50%

Comments: Short-term trends are difficult to interpret because lampreys perhaps may produce stronger year-classes in some years than in others (spawning may not occur in all small streams every year; or perhaps ammocoetes from one spawning may transform to adults over a period of years) (Wydoski and Whitney 2003).

Trend over the past three generations (estimated to be 27 years; Luzier et al. 2011) is uncertain, but distribution and abundance likely have declined in most stream systems across the range (Luzier et al. 2011), and overall population decline may exceed 30 percent. Many or most areas with a stable recent trend underwent declines more than three lamprey generations ago (Luzier et al. 2011).

Global Long Term Trend: Decline of 50 to >90%

Comments: Current distribution and abundance clearly are significantly less than in the historical past (Moyle et al. 2009, Luzier et al. 2011). Decline and risk are particularly severe in the Snake River and upper Columbia River regions, and populations in the mid-Columbia, lower Columbia, and coastal Oregon watersheds also are relatively highly imperiled (Luzier et al. 2011). For example, adult population size in the Columbia River formerly numbered at least hundreds of thousands; now populations are at least an order of magnitude smaller (see Luzier et al. 2011). Current status is poorly known in many areas, including Japan, Alaska, and the Puget Sound and Washington coast regions (Luzier et al. 2011). In California, anadromous Pacific lampreys are still present in most of their native areas, but large runs that formerly characterized streams such as the Eel River seem to have disappeared (Moyle 2002). Actual data are scarce; only anecdotal evidence indicates that runs in north coastal streams are smaller than they used to be (Moyle 2002). Runs have been eliminated from many highly altered or polluted streams, including those in the urbanized southern part of the range, but some populations have nevertheless persisted in spite of habitat disturbance (Moyle 2002, Moyle et al. 2009). See Luzier et al. (2011) for further information on the status of populations in Oregon and Washington, where available data indicate large declines in distribution and abundance.

This species is apparently secure in British Columbia (Renaud et al. 2009). The population in Elise Lake in British Columbia has apparently been extirpated (Beamish and Northcote 1989). In urbanized streams of the lower Fraser River valley in British Columbia, spawning adults are much less common than they were in the 1960s (McPhail 2007). The species appears to be extirpated in the British Columbia portion of the Columbia River system (McPhail 2007).

Studies examining possible Pacific lamprey residency in Japanese rivers have suggested that Asian populations are not well established (Yamazaki et al. 2005, cited by Spice et al. 2011). The Japanese government has listed the Pacific lamprey as "data deficient" for conservation purposes (Japan Ministry of the Environment 2003, cited by Spice et al. 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B?

Comments: Threats include artificial barriers to migration, poor water quality, predation by native and non-native species, stream and floodplain degradation, loss of estuarine habitat, decline in prey, ocean conditions, dredging, and dewatering (see Luzier et al. 2011). Primary threats are barriers on mainstem and tributary streams, streamflow management, stream and floodplain degradation, and reduced water quality (Luzier et al. 2011). The extirpated and most imperiled populations have no healthy lamprey populations nearby to aid in recovery (Luzier et al. 2011).

Hydropower development, habitat alterations, and land management practices (e.g., irrigation) are thought to be responsible for the declines in the Columbia and Snake rivers (Claire and Cochnauer). Many declines are probably the result of obstructions (i.e., dams) that prevent spawning migration of adults and cause habitat degradation of spawning and larval rearing areas (Weeks 1991). Pacific lampreys were formerly common in the Snake, Clearwater, and Salmon river drainages in Idaho, but dams have had an adverse impact on their migration up the Snake River (Wydoski and Whitney 2003). The population in Elsie Lake in British Columbia was apparently extirpated approximately seven years after dams were constructed on the lake's outlet (Beamish and Northcote 1989). The Goose Lake, California, population may be negatively affected by dams and other obstructions that prevent adults from reaching spawning areas and by stream channelization, grazing, and diversions of water for irrigation, which may cause ammocoete habitat to dry up or become unsuitable (Moyle et al. 1989 and 1995).

Severe declines in salmon abundance may also be influential in the lamprey decline because salmon are one of the primary food resources (Wydoski and Whitney 2003).

Pacific lampreys were historically used extensively for food, trade, ceremonial, and medicinal purposes by Indian tribes in Oregon and British Columbia (Scott and Crossman 1973, Weeks 1991). In the 1940s, they were commercially harvested at Willamette Falls on the Willamette River, Oregon. Harvests averaged 300,000 pounds annually and were used to produce a chemical to aid in blood coagulation. Currently, commercial harvest at Willamette Falls ranges from 3,000 to 11,000 pounds annually and is sold as bait or to biological supply houses. Commercial harvest is now prohibited in some areas in Oregon. However, Indian tribes still harvest lamprey for personal use. At Willamette Falls, native harvests are probably comparable to the present level of commercial harvest. In Oregon, native harvests now occur primarily at Bonneville Dam and to a lesser extent at Sherar Falls on the Deschutes River and Willamette Falls, on the Willamette River.

A 1990 spill of hydrochloric acid in John Day River, Oregon, resulted in the death of an estimated 10,000 ammocoetes (Weeks 1991).

Legal harvest of adults and ammocetes occurs in California and Alaska (Luzier et al. 2011), but this is not known to be a significant threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Research Needs: Determine the taxonomic status of the various landlocked populations (Moyle 2002).

Biological Research Needs: Better information is needed on threats and the degree of threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: No known protected sites. The Goose Lake population is listed as threatened in California (Moyle et al. 1995). The state of Oregon listed the Pacific lamprey as a sensitive species in 1993 and followed with protected status in 1996 (Kostow 2002).

Needs: Goose Lake (California) population: improving access and flows in streams, especially Lassen and Willow creeks, would be beneficial to this species and to Goose Lake redband trout (Moyle et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Pacific lampreys seem to have little effect on fish populations, and they are of ecological value as prey for pinnipeds and of economic/cultural value as food for humans (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Management actions and research include: modifications to fish ladders and entranceways at major hydroelectric facilities, culvert modifications and replacements, restoration of side channels and floodplains, consideration of lampreys during in-stream work (salvage operations), water transactions, water quality restoration (sediments, toxicity studies, restoration of flow to reduce high temperatures), identification guides for field biologists and smolt trap operators, and lamprey-specific surveys for distribution and habitat (Luzier et al. 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific lamprey

The Pacific lamprey (Entosphenus tridentatus) is an anadromous parasitic lamprey from the Pacific Coast of North America, and Asia. It is also a member of the Petromyzontidae family. The Pacific lamprey is also known as the Three Tooth lamprey and the Tridentate lamprey.

Description[edit]

Pacific lamprey digging a nest (redd)

Pacific lamprey grow to about 80 centimetres (31 in) as adults. They are anadromous and semelparous. They have slender, elongate bodies with two dorsal fins arising far back on the body. The anal fins are rudimentary and the lower lobe of the caudal fin is larger than the upper lobe and both lobes are continuous with the dorsal fin and the anal fin. Adults living in the sea are a bluish-black or greenish colour above and pale below, but those in fresh water are brown. This species is distinguished by having three (or occasionally two) sharp teeth on the supraoral bar above the mouth and three sharp points on each lateral plate.[1]

Biology[edit]

Although the adult and juvenile stages are more noticeable, lamprey spend the majority of their lives as larvae (ammocoetes). Ammocoetes live in fresh water for many years (usually 3–7 years, but at least one species has been recorded for +17 years). Ammocoetes are filter feeders who draw overlying water into burrows they dig into soft bottom substrates. After the larval period the ammocoetes undergo metamorphosis and take on the juvenile/adult body morphology. Juveniles/adults have a jawless sucker-like mouth that allows them to become parasitic on other fish and sperm whales, attaching themselves with their suckers and feeding on blood and body fluids. The adults live at least one to two years in the ocean and then return to fresh water to spawn. It is not well understood if Pacific lamprey return to their natal streams or seek spawning areas based on other cues. They typically spawn in similar habitat to Pacific salmon and trout. Lamprey construct a nest (redd) in small gravel and females can lay over 100,000 eggs, which are fertilized externally by the male. After spawning the adults usually die within four days. Also, like salmon, the Pacific lamprey does not feed while migrating to spawn.[1]

As food[edit]

Pacific lamprey are an important ceremonial food for Native American tribes in the Columbia River basin. Pacific lamprey numbers in the Columbia River have greatly declined with the construction of the Columbia River hydro-power system. Almost no harvest opportunity for Native Americans remains in the Columbia River and its tributaries except for a small annual harvest at Willamette Falls on the Willamette River (tributary to the Columbia River).

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2012). "Entosphenus tridentatus" in FishBase. April 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The Goose Lake population of L. tridentata, presumably derived from sea-run populations from the Klamath drainage, likely deserves recognition as a distinct subspecies (Moyle et al. 1989, Moyle 2002). Populations in Lake Cowichan and Mesachie Lake, British Columbia, formerly included in L. tridentata, are now regarded as a distinct species, L. macrostoma (Beamish 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!