Overview

Brief Summary

The bluefin tunas are among the largest and fastest open ocean fishes and are important economically and culturally in many parts of the world. There are three species of bluefin tuna- the prized and endangered Atlantic bluefin (Thunnus thynnus), the widespread but similarly overfished Pacific bluefin (Thunnus orientalis), and the smaller but also tasty Southern bluefin tuna (Thunnus mccoyi). Bluefin tunas are spectacular swimming machines with torpedo-shaped, streamlined bodies built for speed and high-powered muscle and tendon systems that have evolved for high endurance. Bluefin tunas are warm-blooded, a rare trait among fish, and are thus able to adjust their body temperature, keeping their body temperatures higher than the surrounding water, which is why they are so well adapted to cooler ocean waters. Bluefin tunas are considered exceptionally good to eat, particularly by those who enjoy various forms of raw fish such as sushi and sashimi, and all species of bluefin tuna are pursued constantly by the fishing industry and by sport fishermen. As a result, overfishing throughout their range has driven their numbers to critically low levels. Some populations of bluefin tuna are thought be extinct and others are critically endangered.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comprehensive Description

Biology

Epipelagic, usually oceanic, but seasonally coming close to shore (Ref. 168). Tolerates ample temperature intervals (Ref. 168). Forms schools by size, sometimes with other scombrids (Ref. 168). Migrates between June and September in a northward direction along the coast of Baja California, Mexico and California (Ref. 168). A voracious predator that feeds on a wide variety of small schooling fishes and squids, also on crabs crabs and to a lesser degree on sessile organisms (Ref. 168). Marketed fresh and frozen.
  • Collette, B.B. 1995 Scombridae. Atunes, bacoretas, bonitos, caballas, estorninos, melva, etc. p. 1521-1543. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9340)   http://www.fishbase.org/references/FBRefSummary.php?id=9340&speccode=93 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: tuna (English), bluefin tuna (English), atún (Espanol)
 
Thunnus orientalis (Temminck & Schlegel, 1844)


Northern bluefin tuna,     Pacific bluefin tuna


Body elongate, fusiform, moderately compressed; no fatty eyelid; teeth slender, conical; top of tongue with 2 cartilaginous ridges; 32-40 gill rakers; 2 dorsal fins barely separated; 1st  dorsal XIII-XV; 8-9 finlets after dorsal and anal fins; pectoral fins very short, no reaching past first dorsal fin; short, forked bony process between pelvic fins; two small keels separated by large keel on tail base; well developed scaly corselet on front of body; small scales cover body behind corselet.


Back metallic dark blue; lower sides and belly silvery white; first dorsal fin yellowish or bluish, second dorsal reddish brown; anal fin and finlets dusky yellow edged with black; tail dark grey; central keel of tail base black in adult.


Size: attains 330 cm, common to 200 cm.

Habitat: oceanic, pelagic.

Depth: 0-550 m.

Pacific, in tropical and temperate seas; California to the SW Gulf of California.

The Pacific and Atlantic populations are recognized as a separate species by Collette (1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is present throughout the Indo-Pacific. It is a temperate species that also extends into tropical waters. There are records of this species in New Zealand and French Polynesia. More information is needed to confirm this species distribution to these areas, and there is no evidence of spawning in these areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Gulf of Alaska to southern California and Baja California and from Sakhalin Island in the southern Sea of Okhotsk south to northern Philippines. There are four substantiated records of this subspecies in the southern hemisphere: off Western Australia, southeast Pacific (37°11'S, 114°41'W) and Gulf of Papua (Ref. 10997). The species occurs mainly in the northern Pacific but ventures into New Zealand waters for at least three months during spring and early summer (Ref. 83312).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 550 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Pacific only (East + Central &/or West), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 330.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

300 cm FL (male/unsexed; (Ref. 9340)); max. published weight: 450.0 kg (Ref. 47525); max. reported age: 15 years (Ref. 83312)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Mean number of gill rakers 35.9. First ventrally directed parapophysis on vertebra number 8. Dorsal wall of body cavity has a narrow bulge with lateral concavity and wide lateral trough. Caudal keels dark.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is an epipelagic and usually oceanic species, but seasonally comes close to the shore. It tolerates wide temperature ranges and forms schools by size, sometimes with other Scombrids. It migrates between June and September in a northward direction along the coast of Baja California, Mexico and California. A model of migration is presented by Bayliff (1994). It is found to 550 m depth. It is a voracious predator that feeds on a wide variety of small schooling fishes or squid, and also eats crabs and less sessile organisms (Collette and Nauen 1983).

Longevity may be as long as 15 years (Hsu 2000) or 26 years (Shimose 2009). Spawning occurs between Japan and the Philippines in April, May, and June, off southern Honshu in July, and in the Sea of Japan in August. The sex ratio is about 1:1. Size at first maturity is 150 cm FL and 60 kg at an age of approximately five years. Batch fecundity increases with length, from about five million eggs at 190 cm FL to about 25 million eggs at 240 cm FL (Collette 2010, Schaefer 2001, Sawada et al. 2005, Chen et al. 2006).

Based on maturity and longevity studies (Collette et al. 2011), the generation length of this species is estimated to be between 7–9 years.

The all-tackle game fish record is of a 325 kg fish caught off Westport, New Zealand in 2007 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 1 - 200 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Sterrhurus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhipidocotyle Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Prosorhynchoides Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelichnibothrium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oesophagocystis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neorhadinorhynchus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nematobothrium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma grossum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Heptachona Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grillotia sp. Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymoproblema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 26. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 25. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 21. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 17. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 14. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 11. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocylindrus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coeliotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bucephalopsis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bolbosoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benedenia Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aponurus lagunculus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anisakis Disease (juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anapleururus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thunnus orientalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1815-06|NC_008455|Thunnus orientalis| ACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTA---AGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGAC---GACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATG---ATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCTCCCTCTTTCCTTCTGCTCCTAGCTTCTTCAGGAGTTGAGGCTGGGGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTAGCCCACGCAGGGGCATCAGTTGACCTA---ACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCCATCTCTCAATATCAAACACCACTGTTTGTATGAGCTGTACTAATTACAGCTGTTCTTCTTCTACTTTCCCTTCCAGTCCTTGCCGCT---GGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAGCATCTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCCGGATTCGGAATGATTTCCCACATTGTTGCCTACTACTCAGGTAAAAAA---GAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATTGTATGAGCCCACCACATGTTCACGGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus orientalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., Chiang, W., Di Natale, A., Die, D., Fox, W., Graves, J., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Nelson, R., Restrepo, V., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This a is highly commercial and valuable species. The stock is considered fully exploited, with catches being relatively stable in the past five to 10 years. Estimates of spawning stock biomass (SSB) have shown an increasing trend over the past 21–27 years (three generation lengths). It is listed as Least Concern. However, given the conflicting management advice from different RMFO's, it is recommended that one management body take responsibility for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
FAO worldwide reported landings show a increase from 1,452 tonnes in 1950 to 31,542 tonnes in 1961, then gradually decreasing to less 8,049 tonnes in 1984. Landings from 1985 to present have fluctuated, but are relatively stable between 5,800–10,000 tonnes from 1985–2006 (FAO 2009). In the Pacific, the catch from 2000–2004 is reported as 16,000–29,000 tonnes/year, and the status of the stock is Fully Exploited (Majikowski 2007). In April 2011, the Southwest Fisheries Science Center of the US National Marine Fisheries Service found that overfishing is occurring on Pacific Bluefin Tuna but that the stock was not in an overfished condition (Menashes 2011).

For the entire Pacific, half of the stock is caught in the Eastern Pacific Ocean, and the other half in the Western Pacific Ocean. The Eastern Pacific is likely half of the Pacific catch, but no good stock assessment exists. Based on FAO data, there is an apparent decrease in total landings for the Eastern Pacific between 1994–2004 from approximately 9,000 mt to approximately 3,000 mt, but data from the Inter-American Tropical Tuna Commission (IATTC) over the same time period is relatively constant at around 2,000–3,000 mt with some peaks of 8,000 mts and 9,000 mts in 2004 and 2006 (IATTC 2008). The majority of the catch is off of Baja California. Catch numbers have naturally fluctuated based on population migration. This species spawns in the Sea of Japan, and an unknown proportion migrates to the Eastern Pacific, stays a few years, and then migrates back to the Western Pacific. Fluctuations in catch in the Eastern Pacific are thus results of the proportion of migrants that come to the Eastern Pacific. Similarly, the consecutive years of above average catches in the Eastern Pacific (mid-1950s to mid-1960s) and below-average catches (early 1980s to early 1990s) could be due to consecutive years of above-average and below-average recruitments (IATTC 2010).

Based on a 2008 stock assessment (ISC 2008), evaluation of the stock is not straightforward. From the late 1980s, spawning stock biomass (SSB) has recovered to about 30,000 t by the mid-1990s, and then declined again to 20,000 t. At this level, SSB in 2005 was near the median level over the assessment period (1952–2004). Total catch fluctuated widely in the range of 9,000–40,000 t during the assessment time period, while recent catches have been near the average for the assessment period (~22,000 t). Over the entire catch history, annual catch has never attained the equilibrium catch at FMSY (45,000 t).

Based on updates to this assessment that were conducted in 2009 (ISC 2009) and 2010 (ISC 2010), the estimated spawning biomass in 2008 declined from the last estimate of 2006 and is in the range of 40–60% of the historically observed spawning biomasses. Average fishing mortality from 2004–2006 (F2004-2006) has increased for all age classes, and 30-year projections predict that at F2004-2006 median spawning biomass is likely to decline to levels around the 25th percentile of historical spawning biomass with approximately 5% of the projections declining to or below the lowest previously observed spawning biomass. At F2002-2004 median spawning biomass is likely to decline in subsequent years but recover to levels near the median of the historically observed levels. In contrast to F2004-2006, F2002-2004 had no projections (0%) declining to the lowest observed spawning biomass (ISC 2010).

Based on linear regression of estimated SSB (ISC 2008, ISC 2009), the stock shows an increasing trend over the past 21–27 years (from 1984–2006 and from 1986–2006).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In the Northern Pacific, this species is fished with set net, trolling, and purse seines. Most of the catch in the Eastern Pacific is taken by purse seines. A considerable portion of the purse seine catch is transported to holding pens for fattening and later sale as sashimi grade fish (IATTC 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Mexico has quotas in place to limit the amount of fish that can be caught for fish farms. There is no longer any US catch for this species, and historically high catches for the U.S. are likely due to U.S. fishing in Mexican waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pacific bluefin tuna

The Pacific bluefin tuna (Thunnus orientalis) is a predatory species of tuna found widely in the northern Pacific Ocean, but it is migratory and also recorded as a visitor to the south Pacific.[1] In the past it was often included in T. thynnus, the 'combined' species then known as the northern bluefin tuna (when treated as separate, T. thynnus is called the Atlantic bluefin tuna).[2] It may reach as much as 3 m (9.8 ft) in length and 450 kg (990 lb) in weight.[3]

Like the closely related Atlantic bluefin and southern bluefin, the Pacific bluefin is a commercially valuable species and several thousand tonnes are caught each year, but unlike its relatives it does not appear to be threatened overall, despite being overfished.[1] Monterey Bay Aquarium's Seafood Watch program have placed all bluefin tunas on the "Avoid" list,[4] and they are also placed on Greenpeace's "Red List".[5]

Contents

Physiology

Thermoregulation

Most fish are cold-blooded (ectothermic). [6] However, tuna and mackerel sharks are warm-blooded: they can regulate their body temperature. Warm-blooded fish possess organs near their muscles called retia mirabilia that consist of a series of minute parallel veins and arteries that supply and drain the muscles. As the warmer blood in the veins returns to the gills for fresh oxygen it comes into close contact with cold, newly oxygenated blood in the arteries. The system acts as a counter-current heat exchanger and the heat from the blood in the veins is given up to the colder arterial blood rather than being lost at the gills. The net effect is an increase in temperature. Fish from warmer water elevate their temperature a few degrees whereas those from cold water may raise it as much as 20 °C (36 °F) warmer than the surrounding sea.

The tuna's ability to maintain body temperature has several definite advantages over other sea life. It need not limit its range according to water temperature, nor is it dominated by climatic changes. The additional heat supplied to the muscles is also advantageous because of the resulting extra power and speed. Bluefin tuna have been clocked in excess of 30 miles per hour (48 km/h) during 10 to 20 second sprints, enabling it to hunt squid, herring, mackerel, etc., that slower predators cannot capture.

Distribution

The Pacific bluefin tuna is primarily found in the North Pacific, ranging from the East Asian coast to the western coast of North America.[1][3] It is mainly a pelagic species found in temperate oceans, but it also ranges into the tropics and more coastal regions.[1] It typically occurs from the surface to 200 m (660 ft),[3] but has been recorded as deep as 550 m (1,800 ft).[1]

It spawns in the northwestern Philippine Sea (e.g., off Honshu, Okinawa and Taiwan) and in the Sea of Japan.[1][7] A proportion of these migrate to the East Pacific and return to the spawning grounds after a few years.[1] It has been recorded more locally as a visitor to the Southern Hemisphere, including off Australia, New Zealand, Gulf of Papua and French Polynesia.[1][3]

Life history

Pacific bluefin tunas reach maturity at about 5 years of age, the generation length is estimated at 7–9 years and based on two separate sources the longevity is 15 year or 26 years.[1] At maturity it is about 1.5 m (4 ft 11 in) long and weighs about 60 kg (130 lb).[1] Individuals that are 2 m (6 ft 7 in) long are regularly seen, and the maximum reported is 3 m (9.8 ft) in length and 450 kg (990 lb) in weight.[3] According to the International Game Fish Association, the all-tackle game fish record was a 325 kg (720 lb) individual caught off New Zealand in 1997.[1]

Spawning occurs from April to August, but the exact timing depends on the region: Early in the northwest Philippine Sea (the southern part of its breeding range) and late in the Sea of Japan (the northern part of its breeding range).[1] Large females can carry more eggs than small ones, and between 5 million and 25 million eggs have been reported.[1]

Pacific bluefins eat various small schooling squids and fishes, but has also been recorded taking sessile animals,[3] pelagic red crabs and krill.[7]

Conservation status

Unlike the other bluefins (Atlantic and southern),[8][9] the Pacific bluefin tuna is not listed as threatened by the IUCN.[1] Overfishing is occurring in the Pacific bluefin, but overall the stock is not in an overfished condition.[10] In 2000–2004, between 16,000 tonnes and 29,000 tonnes were caught per year.[1] Its wide range and migratory behavior leads to some problems, since fisheries in the species are managed by several different Regional Fisheries Management Organisations that sometimes give conflicting advice. The IUCN have recommended that the responsibility is moved to a single organisation.[1] In 2010, it was estimated that the complete spawning biomass was 40–60% of the historically observed spawning biomass.[1]

Monterey Bay Aquarium's Seafood Watch program have placed all bluefin tunas on the "Avoid" list,[4] and they are also placed on Greenpeace's "Red List".[5] Pacific bluefin tuna caught both by purse seine and trolling are yellow listed (green=best, yellow=intermediate, red=worst) by the seafood guide of the Blue Ocean Institute, indicating that some problems exist with this species' status.[11][12]

Pacific bluefin flesh may contain levels of mercury or PCBs that are harmful to humans that consume it.[11] A similar problem exists in other tuna species.

About 80% of the Pacific and Atlantic bluefin tunas are consumed in Japan, and tunas that are particular suited for sashimi and sushi can reach very high prices: In January 2012, a Pacific bluefin weighing 269 kg (590 lb) was sold for 56.49 million yen (about US$736,000) at the Tsukiji fish market in Tokyo, equalling 210,000 yen per kilogram, or US$1,238 per pound.[13] Both the overall price and the price per weight was a record.[13]

Farming

Japan is both the biggest consumer and the leader in over tuna farming research.[14][15] Kinki University of Japan first successfully farmed already-hatched bluefin tuna in 1979. In 2002, they succeeded in breeding them, and in 2007, the process was repeated for a third generation.[16][17][18] This farm-raised tuna is now known as Kindai tuna. Kindai is a contraction of Kinki University (Kinki daigaku).[19]

References

  1. ^ a b c d e f g h i j k l m n o p q r Collette, B., Acero, A., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., Chiang, W., Di Natale, A., Die, D., Fox, W., Graves, J., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Nelson, R., Restrepo, V., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Uozumi, Y. & Yanez, E. (2011). "Thunnus orientalis". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/170341. Retrieved 30 December 2011. 
  2. ^ Collette, B.B. (1999). Mackerels, molecules, and morphology. In: Proceedings of the 5th Indo-Pacific Fish Conference, Noumea. pp. 149-164
  3. ^ a b c d e f Froese, Rainer, and Daniel Pauly, eds. (2011). "Thunnus orientalis" in FishBase. December 2011 version.
  4. ^ a b Monterey Bay Aquarium Seafood Watch. Bluefin tuna. Accessed 30 December 2011
  5. ^ a b Greenpeace. Red List Fish. Accessed 30 December 2011
  6. ^ Purves, William; Sadava, David; Orians, Gordon; Heller, H. Craig (December 15, 2000). Life: The Science of Biology, Sixth Edition. W. H. Freeman. pp. 704. ISBN 978-0-7167-3873-2. http://www.amazon.com/Life-Science-William-K-Purves/dp/0716738732. 
  7. ^ a b Monterey Bay Aquarium. Pacific bluefin tuna. Accessed 30 December 2011
  8. ^ Collette, B., Amorim, A.F., Boustany, A., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Kada, O., Minte Vera, C., Miyabe, N., Nelson, R., Oxenford, H., Pollard, D., Restrepo, V., Schratwieser, J., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E. & Uozumi, Y. (2011). "Thunnus thynnus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21860. Retrieved 30 December 2011. 
  9. ^ Collette, B., Chang, S.-K., Di Natale, A., Fox, W., Juan Jorda, M., Miyabe, N., Nelson, R., Uozumi, Y. & Wang, S. (2011). "Thunnus maccoyii". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21858. Retrieved 30 December 2011. 
  10. ^ Menashes, E.H. (2011). Fisheries of the Pacific region; western Pacific region. Federal Register 76(5): 28422.
  11. ^ a b Blue Ocean Institute. Pacific bluefin tuna - purse seine caught. Accessed 30 December 2011
  12. ^ Blue Ocean Institute. Pacific bluefin tuna - troll caught. Accessed 30 December 2011
  13. ^ a b Washington Post (5 January 2011). Swank sushi: Bluefin tuna nets $736,000 at Tokyo auction, easily beating old record. Accessed 6 January 2011
  14. ^ http://www.livescience.com/animals/080317-sl-tuna-farming.html
  15. ^ Ito, Masami, "Does Japan's affair with tuna mean loving it to extinction?", Japan Times, August 31, 2010, p. 3.
  16. ^ "The holy grail of fish breeding". http://www.taipeitimes.com/News/editorials/archives/2006/09/30/2003329854. 
  17. ^ http://www.flku.jp/english/aquaculture/index.html
  18. ^ Jung, Carolyn (2008-05-21). The San Francisco Chronicle. http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2008/05/21/FDI910LR9P.DTL&type=printable. 
  19. ^ http://nymag.com/restaurants/features/46633/
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!