Overview

Comprehensive Description

Biology

Found on coral reefs (Ref. 12204). Solitary or in small groups (Ref. 9710). Feeds on a wide variety of small bottom invertebrates such as mollusks, crustaceans, worms, sessile tunicates and sponges exposed by a jet of water ejected through the mouth (Ref. 9710). Marketed fresh locally (Ref. 3696). Toxins released when excited kill other fishes (Ref. 5521). Easily approached (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Canada (Ref. 12204) and Massachusetts, USA to Brazil, including Bermuda, the Gulf of Mexico and the Caribbean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

47.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Carapace and caudal peduncle blackish with numerous small white spots; lips and bases of fins blackish; terminal edge of caudal fin narrowly white with a blackish submarginal band (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 50 m (Ref. 12204)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0.5 - 37
  Temperature range (°C): 24.203 - 27.724
  Nitrate (umol/L): 0.256 - 1.474
  Salinity (PPS): 34.217 - 36.231
  Oxygen (ml/l): 4.538 - 4.657
  Phosphate (umol/l): 0.114 - 0.169
  Silicate (umol/l): 0.993 - 2.813

Graphical representation

Depth range (m): 0.5 - 37

Temperature range (°C): 24.203 - 27.724

Nitrate (umol/L): 0.256 - 1.474

Salinity (PPS): 34.217 - 36.231

Oxygen (ml/l): 4.538 - 4.657

Phosphate (umol/l): 0.114 - 0.169

Silicate (umol/l): 0.993 - 2.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on coral reefs (Ref. 12204). Feeds on a wide variety of small bottom invertebrates such as mollusks, crustaceans, worms, sessile tunicates and sponges exposed by a jet of water ejected through the mouth (Ref. 9710). Omnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinesomus triqueter

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATTTAGTATTTGGTGCTTGAGCCGGTATAGTAGGGACAGCCCTAAGCCTACTCATCCGAGCAGAACTGAGCCAACCAGGCGCTCTCCTTGGGGATGATCAGATTTACAATGTTATTGTCACGGCACATGCATTCGTGATAATTTTCTTTATAGTTATACCCATCATAATCGGAGGTTTTGGAAACTGACTAGTCCCATTAATAATTGGGGCCCCCGACATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTTCCCCCTTCCTTTCTTCTTCTCCTAGCTTCATCAGGAGTTGAAGCAGGGGCAGGAACTGGTTGGACAGTTTACCCGCCCTTAGCAGGAAACCTAGCACACGCGGGAGCATCCGTAGATTTAACTATTTTTTCACTTCATCTAGCGGGAGTCTCCTCAATTCTAGGGGCTATTAATTTTATTACCACCATTATTAACATAAAACCCCCTGCTATCTCTCAATATCAAACCCCCTTATTTGTTTGGGCTGTCTTAATTACCGCCGTTCTTCTCCTCTTATCTCTACCAGTTCTTGCTGCCGGCATCACAATGCTCCTAACAGACCGAAATCTCAACACCACCTTCTTTGACCCAGCAGGAGGCGGAGACCCAATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinesomus triqueter

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rhinesomus

Rhinesomus triqueter, the smooth trunkfish, is a species of boxfish found on and near reefs in the Caribbean Sea, Gulf of Mexico and subtropical parts of the western Atlantic Ocean. It is the only known member of its genus.

Taxonomy[edit]

The names Lactophrys triqueter and Rhinesomus triqueter are synonymous. The former is accepted by the Encyclopedia of Life [1] but the World Register of Marine Species [2] and FishBase [3] recognize Rhinesomus triqueter as the valid name.

Description[edit]

The smooth trunkfish has an angular body sheathed in plate-like scales, growing to a maximum length of 47 centimetres (19 in), though 20 cm (8 in) is a more normal size. The body is enclosed in a bony carapace and, when viewed from the front, is triangular in shape with a narrow top and wide base. The fish has a pointed snout with protuberant lips encircling a small mouth. The tail is shaped like a brush. The general background colour is dark with a pattern of small white spots, often in hexagonal groups giving a honeycomb-like appearance in the middle area of the body. The tip of the snout and the area round the pectoral fins are dark with few spots and the eyes are black. The fins are usually yellowish with a dark base and tips. They have only soft rays with no spines.[4][5]

The juveniles have dark coloured bodies covered in large yellow spots. As they get older, they develop a pale area where the honeycomb markings will later appear.[5]

Distribution[edit]

The smooth trunkfish is found down to a depth of about 50 m (164 ft) on coral reefs and over sandy seabeds in the Caribbean Sea, Gulf of Mexico and the western Atlantic Ocean. The range extends from Canada and the Gulf of Maine southwards to Brazil.[3]

Biology[edit]

Lactophrys triqueter - pone.0010676.g196.png

The smooth trunkfish is normally solitary but sometimes moves around in small groups. It uses its protuberant lips to expel a jet of water which disturbs the sandy seabed and reveals any shallowly buried benthic invertebrates. It feeds on small molluscs, polychaete worms, acorn worms, peanut worms, small crustaceans, sponges and tunicates.[3][5]

Uses[edit]

In some regions, the smooth trunkfish is caught for human consumption.[3] It is also sometimes kept in reef aquaria. Caution needs to be used however as it produces a toxic substance, ostracitoxin, in mucous secretions from the skin. When the fish is stressed this is liberated into the water and some aquarium tanks and systems have been poisoned by this with the loss of all the other animal inhabitants.[6]

References[edit]

  1. ^ a b Lactophrys triqueter Encyclopedia of Life. Retrieved 2012-01-01.
  2. ^ Bailly, Nicolas (2010). "Rhinesomus triqueter (Linnaeus, 1758)". World Register of Marine Species. Retrieved 2012-01-01. 
  3. ^ a b c d Rhinesomus triqueter (Linnaeus, 1758) FishBase. Retrieved 2012-01-01.
  4. ^ Smooth trunkfish (Lactophrys triqueter) Marine Species Identification Portal. Retrieved 2012-01-01.
  5. ^ a b c Lactophrys triqueter; Linnaeus, 1758 Smithsonian Tropical Research Institute. Retrieved 2012-01-01.
  6. ^ The Puffers Called Box-, Cowfishes, family Ostraciidae WetWebMedia. Retrieved 2012-01-01.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!