Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: remora (English), rémora (Espanol)
 
Remora remora (Linnaeus, 1758)


Common remora



Elongate, moderately robust; distinctive flat head with sucking disc of 16-22 plates, reaches to about end of pectoral fin; lower jaw projecting; gill rakers 28-37, 26-28 lower rakers; dorsal rays 21-27; anal rays 20-24; pectoral rays 25-32; tail fin slightly concave to straight; pelvics broadly joined to belly.



Uniformly dark greyish brown.


Size: grows to 86 cm.

Habitat: commonly attached to sharks, sometimes in gill chamber, but also on large fishes, rays, and turtles.

Depth: 0-200 m?

Circumtropical; throughout the tropical eastern Pacific except for the upper Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Usually associated with sharks but also attaches itself to other large fishes, sea turtles and even ships (Ref. 2850, 58302); found in gill chambers, fins and body surface (Ref. 5951). Sometimes free-swimming (Ref. 2850). Younger individual is more active as parasite pickers (Ref. 26938). Feeds on parasitic copepods (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

cosmopolitan in warm seas, occasionally straying into the western North Atlantic north of Cape Cod to St. Pierre Bank off Nova Scotia in association with host species; Western Atlantic: Nova Scotia, Canada to Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan in warm waters. Western Pacific: Japan (Ref. 559) to New Zealand and Norfolk Island (Ref. 8879). Eastern Pacific: San Francisco in California, USA to Chile (Ref. 2850). Western Atlantic: Nova Scotia, Canada to Argentina (Ref. 7251). Eastern Atlantic: North Sea to the Canary Islands, including the western Mediterranean. Recorded from Iceland (Ref. 13583) and between Sweden and Denmark (Ref. 28571).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Common in warmer parts of all oceans.Western Mediterranean and Atlantic from the North Sea southwards (Unesco 1989).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through temperate seas (including western Baltic Sea, North Sea, Mediterranean Sea, Red Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tropical seas generally; very common in the West Indies, and occasionally north to Cape Cod, but may stray north of Cape Cod.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Lachner, E.A. and A. Post, 1990; Norman, J.R., 1939; Muus, B.J. and J.G. Nielsen, 1999; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 200 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 22 - 26; Analspines: 0; Analsoft rays: 22 - 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Remora remora is a short, thick-set sucking fish (Marshall 1965).The Remora has 28-37 long slender gillrakers, 21-27 dorsal fin rays, 20-24 anal fin rays, and 25-32 pectoral fin ray (Unesco 1989). The dorsal and anal fins lack spines (Nelson 1984). The Remora has no swim bladder and uses a sucking disc on the top of its head to obtain rides from other animals such as large sharks, and sea turtles. The sucking disk, developed from a transformed spinous dorsal fin, contains 16-20 transverse movable lamina which create a partial vaccuum permitting the Remora to obtain rides on larger animals (Nelson 1984). The head is rather long and flattened, 26-29% of the standard length, with the disc being 34-42% of the standard length. The lower jaw projects past the upper jaw and the teeth, located in jaws and vomer in a villiform patch, are sharply pointed and recurved slightly inward. The scales are small and cycloid (Unesco 1989, Nelson 1984), and the color, nearly uniform above and below, is blackish or brownish (Marshall 1965). The Remora grows to about 18 inches (Marshall 1965).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 86.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 864 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

86.4 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 1,070 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 86.4 cm TL (male/unsexed).
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Lachner, E.A. and A. Post, 1990; Norman, J.R., 1939; Muus, B.J. and J.G. Nielsen, 1999; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Usually associated with sharks but also attaches itself to other large fishes, sea turtles and even ships. Sometimes free-swimming (Ref. 2850).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dark brownish grey in color (Ref. 4389). During the course of development, fin is transformed into a suction disc (Ref. 35388). Deeper-bodied than Echeneis naucrates (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

usually associated with sharks but also attaches itself to other large fishes, sea turtles and even ships; sometimes free-swimming
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 100 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Remora is a pelagic marine fish that is usually found in the warmer parts of most oceans clinging on to large sharks, sea turtles, bony fishes and other marine mammals (Marshall 1965).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 66 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0 - 3850
  Temperature range (°C): 1.296 - 27.331
  Nitrate (umol/L): 0.055 - 33.888
  Salinity (PPS): 33.402 - 36.393
  Oxygen (ml/l): 2.116 - 6.250
  Phosphate (umol/l): 0.100 - 2.385
  Silicate (umol/l): 1.042 - 133.498

Graphical representation

Depth range (m): 0 - 3850

Temperature range (°C): 1.296 - 27.331

Nitrate (umol/L): 0.055 - 33.888

Salinity (PPS): 33.402 - 36.393

Oxygen (ml/l): 2.116 - 6.250

Phosphate (umol/l): 0.100 - 2.385

Silicate (umol/l): 1.042 - 133.498
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; marine. Usually attached onto a shark but also can be found on other large fishes, sea turtles and even ships. May be free-swimming.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Lachner, E.A. and A. Post, 1990; Norman, J.R., 1939; Muus, B.J. and J.G. Nielsen, 1999; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Near Surface, Mid Water, Water column only

Habitat: Water column, Large fishes (billfishes, rays, sharks, etc), turtles & whales

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Usually associated with sharks but also attaches itself to other large fishes, sea turtles and even ships (Ref. 2850, 58302); found in gill chambers, fins and body surface (Ref. 5951). Sometimes free-swimming (Ref. 2850). Younger individual is more active as parasite pickers (Ref. 26938). Feeds on parasitic copepods (Ref. 35388); planktonic and benthic invertebrates (Ref. 33).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The Remora clings to a host, such as large sharks, sea turtles, bony fishes, rays, and marine mammals.The Remora has long been thought to detach itself from its host and dart around feeding on its scraps (Herald 1962). It was later felt that ectoparasites on the host's body or gill chambers formed an important part of their diet. Recently it was shown that both of these are utilized as food sources and that planktonic organisms and fish may also be part of the Remora's diet (Bohlke and Chaplin 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Parasitic copepods. Younger individuals remove parasites off host fish.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Lachner, E.A. and A. Post, 1990; Norman, J.R., 1939; Muus, B.J. and J.G. Nielsen, 1999; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore, Planktivore, Ectoparasite cleaner

Diet: Pelagic crustacea, zooplankton, ectoparasites, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on parasitic copepods
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Near nothing is known about the Remora's breeding habits or larval development.Specimens as small as an inch have been noted to resemble adults in all aspects except size, but nothing is known about how or where they spawn (McClane 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

no information.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Lachner, E.A. and A. Post, 1990; Norman, J.R., 1939; Muus, B.J. and J.G. Nielsen, 1999; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Remora remora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Remora remora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTCGGGGCCTGAGCCGGAATAGTGGGAACCGCACTAAGCCTGCTTATTCGAGCAGAACTTAGTCAGCCAGGCTCCCTACTGGGCGATGACCAGGTATATAATGTTATCGTTACAGCCCACGCCTTTGTAATAATTTTCTTTATAGTTATACCAGTTATGATTGGAGGCTTTGGAAATTGACTCGTACCCCTTATAATTGGTGCACCCGACATAGCCTTCCCCCGAATGAACAACATAAGCTTTTGGCTTCTACCTCCCTCTTTTCTTCTGCTATTAACATCTTCCGGCGTAGAAGCAGGGGCAGGAACGGGCTGGACCGTCTACCCTCCTTTAGCCGGAAACCTTGCCCATGCAGGAGCCTCCGTAGATTTAACCATCTTTTCCCTTCACTTAGCGGGAATTTCCTCAATTCTTGGGGCAATTAACTTTATTACAACTATTATTAATATAAAACCTGCAGCTGCCTCTATGTATCAACTTCCTCTGTTCGTCTGAGCAGTTCTTATTACAGCGGTTCTTCTCCTACTATCTCTCCCTGTCCTTGCTGCCGGAATTACAATGCTTCTAACAGATCGAAATCTAAATACTGCCTTTTTTGACCCGGCAGGAGGAGGAGACCCCATCCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

No known negative impacts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The remora is of unique value to humans. The fish itself is not generally eaten, but is instead used as a means of catching large fish and sea turtles. Fishermen in countries around the world use them by attaching a line to their tails and then releasing them. The remora will then swim off and attach itself to a large fish or turtle, which can then be pulled in by a careful fisherman. The remora is not held in high esteem as a food fish, although the Australian aborigines are said to eat them after using them on fishing trips. On the other hand, aborigines from the West Indies never ate their "hunting fish" and instead sang songs of praise and reverence to them.

  • McClane, J. 1998. McClanes New Standard Fishing Encyclopedia and International Fishing Guide. New York, NY: Gramercy Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common remora

The common remora, Remora remora, is a pelagic marine fish[1] belonging to family Echeneidae. R. remora is different from other remoras in the family Echeneidae by the modification of its dorsal fin.[2] The dorsal fin, which has 22 to 26 soft rays, acts as a suction cup, creating a vacuum[3] to allow it to attach to larger marine animals, such as whales, dolphins, sharks, and sea turtles.[4]

Physical characteristics[edit]

The common remora has a suckerlike dorsal fin and an anal fin. Its body can be brown, black or grey in color.[5] This species can reach 86.4 cm (34.0 in) in total length, though most do not exceed 40 cm (16 in).[6] The maximum known weight of this species is 1.1 kg (2.4 lb).[6]

Biology and behavior[edit]

R. remora and its host seem to partake in a symbiotic relationship; the common remora does not seem to have a negative effect on its host. The host provides the remora with fast-moving water to bathe its gills, a steady flow of food, transportation, and protection.[7] The common remora's attachment to one host can last for up to three months.[8] During this time, the remora can move its attachment site if it feels threatened.[9] The common remora cannot survive in still water; it needs water flow over its gills to provide it oxygen.

Habitat[edit]

This remora is commonly found in warm marine waters and have been seen in the western Mediterranean and the Atlantic, as well as the North Sea.

museum specimen, dorsal view

Reproduction[edit]

A mating couple may attach to the same host, and have host fidelity.[10] It is not clear when during the year the common remora spawns, and little is known about the fish's reproductive behavior.

Food and diet[edit]

The remora consumes food scraps from its host, as well as plankton and parasitic copepods.

Significance to humans[edit]

No known negative impacts for humans are known. Remoras can be caught as fishing bycatch and put in aquaria.[11] Remoras have been used in fishing. Humans may attach fishing line to the remora and wait for it to cling to a larger fish.[12]

References[edit]

  1. ^ Leao, Mark; Kimberly Schulz (editor) (2002). "Remora remora (on-line)". Animal Diversity Web. Retrieved 2009-06-02. 
  2. ^ Encyclopedia of Biodiversity. Volume 2, D-F1. Simon Asher Levin, Editor in Chief. San Francisco, CA: Academic Press, 2001. Pg. 770
  3. ^ Fishes of the World, 3rd edition. Joseph S. Nelson. New York, NY: John Wiley and Sons, Inc, 1994. Pg. 351
  4. ^ Neotropical ichthyology: Turtle riders: remoras on marine turtles in Southwest Atlantic by Ivan Sazima & Alice Grossman
  5. ^ Smith's Sea Fishes, 6th edition. Edited by Margaret M. Smith and Phillip C. Heemstra. New York, NY: Springer-Verlag, 1986. Pg. 662
  6. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Remora remora" in FishBase. April 2013 version.
  7. ^ Marine Mammal Science: Sharksucker (Echeneis naucrates) on a bottlenose dolphin (Tursiops truncates) and a review of other cetacean-remora associations by D. Fertl Marine Mammal Science, Vol. 15, No. 3, 1999
  8. ^ Neotropical ichthyology: Fishes associated with spinner dolphins at Fernando de Noronha Archipelago, tropical Western Atlantic: an update and overview by Ivan Sazima Accepted Nov. 2006
  9. ^ Whale suckers on Spinner Dolphins: An underwater view by Jose Martins Silva-Jr and Ivan Sazima. Biodiversity records, online 11 February 2006
  10. ^ Whalesuckers and A Spinner Dolphin Bonded for Weeks: Does Host Fidelity Pay Off? By Jose Martin Silvas-Jr and Ivan Sazima. Accepted 24 October 2003
  11. ^ Grizmek’s Animal Life Encyclopedia, 2nd edition. Volume 5, Fishes 11, edited by Michael Hutchins, Dennis A. Thoney, Paul V. Loiselle, and Neil Schlager. Farmington Hills, MI: Gale Group, 2003. Pg. 216
  12. ^ Fishes, Ascidians, Etc. Volume 7. Edited by Sir S.F. Harmer and Sir A.E. Shipley. London: McMillan and Co., Limited. 1932. Pg. 691
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!