Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: slender (English), sunfish (English), ranzania (Espanol), mola (Espanol), pez-sol (Espanol)
 
Ranzania laevis (Pennant, 1776)


Slender mola,     Slender sunfish



Body an elongate oval (depth 25-48% of SL), strongly compressed; mouth small, funnel like, a vertical slit when closed, opens at the front, is a beak (without a central suture) composed of teeth fused to the jaws; gill openings small, on side just before pectorals; pectorals long, pointed; no pelvics; 17-19 rays; anal 18-19 rays; pectoral 13 rays; no tail base;  dorsal and anal fins long and high, symmetrical, used for locomotion, at rear of body, their rear rays joined to tail fin immediately behind them that is reduced to a vertically elongate, short, blunt rudder, with oblique profile, no rear pointed extension; skin smooth, covered with small, hard, hexagonal plates.



Dark grey to dark blue above, silvery on sides and belly; head and lower belly with thin undulating black-edged white bars; white spots and vertical streaks on body between dorsal and anal fins.

        Size: 100 cm.

Habitat: oceanic.

        
        Depth: 0-200 m.

        Circumtropical; possibly throughout our region except most of the Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Oceanic (Ref. 2850), epipelagic (Ref. 2340), and generally solitary (Ref. 9317). Feeds on planktonic crustaceans (Ref. 4424).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan. Western Atlantic: Florida (USA), Martinique, Venezuela (Ref. 51183), and Brazil. Eastern Atlantic: Madeira to Scandinavia (Ref. 4711); Dakar, Senegambie, and Sierra Leone (Ref. 6952); South Africa. Eastern Pacific: central California, USA to Chile; rare north of Mexico (Ref. 2850). Indian Ocean: Madagascar (Ref. 33390), Mauritius (Ref. 58078), Reunion (Ref. 53568), Iran (Ref. 86583), Australia (49596). West Pacific: Japan (Ref. 559), China (Ref. 57879), Taiwan (Ref. 12711), New Zealand (Ref. 5755).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 200 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 18; Analspines: 0; Analsoft rays: 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 100.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 810 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Caudal fin present in postlarvae but resorbed during metamorphosis and replaced by a clavus (Ref. 4424). Body elongated, Mouth slit vertical (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Ranzania laevis
Catalog Number: USNM 75155
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Collector(s): H. Kapu
Year Collected: 1892
Locality: Hawaiian Islands, Hawaii, United States, Pacific
  • Type: Jenkins, O. P. 1895. Proceedings of the California Academy of Sciences, Second Series. 5: 779, figs. 1-3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 1 - 140 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 2.5 - 205
  Temperature range (°C): 18.631 - 25.755
  Nitrate (umol/L): 0.688 - 3.797
  Salinity (PPS): 36.066 - 37.058
  Oxygen (ml/l): 4.679 - 4.758
  Phosphate (umol/l): 0.112 - 0.388
  Silicate (umol/l): 1.459 - 3.512

Graphical representation

Depth range (m): 2.5 - 205

Temperature range (°C): 18.631 - 25.755

Nitrate (umol/L): 0.688 - 3.797

Salinity (PPS): 36.066 - 37.058

Oxygen (ml/l): 4.679 - 4.758

Phosphate (umol/l): 0.112 - 0.388

Silicate (umol/l): 1.459 - 3.512
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Oceanic (Ref. 2850), epipelagic (Ref. 2340), and generally solitary (Ref. 9317). Feeds on planktonic crustaceans (Ref. 4424).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: zooplankton, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ranzania laevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTCGGTGCATGAGCTGGAATAGTGGGAACGGCTTTAAGTCTACTCATCCGAGCAGAACTAAGCCAACCCGGGGCTCTCCTTGGAGACGACCAAATCTACAATGTCATCGTCACAGCACATGCCTTTGTAATGATTTTCTTTATAGTAATACCAATTATGATCGGAGGATTCGGCAACTGACTGATCCCCCTAATGATCGGGGCCCCAGATATGGCCTTCCCTCGAATGAACAACATGAGCTTTTGACTCCTACCCCCCTCATTCCTTCTTCTTCTTGCCTCATCAGGCGTTGAAGCTGGAGCCGGGACAGGATGAACTGTCTACCCTCCTTTAGCCGGAAATTTAGCCCATGCAGGCGCTTCCGTTGACTTAACCATCTTTTCCCTCCACCTGGCTGGTATTTCATCAATTCTTGGGGCTATTAATTTTATTACAACAATTATTAATATGAAACCCCCTGCAATCTCGCAATACCAAACCCCTCTATTTGTCTGAGCAGTTCTCATTACAGCTGTTCTTCTTCTCCTATCCCTCCCAGTTCTTGCAGCAGGGATTACAATGCTCCTCACCGACCGAAATCTAAACACCACTTTCTTCGACCCGGCTGGAGGAGGAGACCCAATTCTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ranzania laevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Slender sunfish

The slender sunfish, Ranzania laevis, is a mola of the family Molidae, the only member of the genus Ranzania, found globally in tropical and temperate seas. Its length is up to 1 m (3.3 ft).

Gallery[edit]

References[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Ranzania laevis" in FishBase. March 2006 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8
  • [1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!