Overview

Comprehensive Description

Biology

Remains in deep recesses during the day. Rarely seen (Ref. 9710). Found in holes and caves in coral reefs (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda (Ref. 9710), southern Florida (USA), and the Bahamas to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic from Florida to Venezuela, Gulf of Mexico, Carribbean Sea, Bahamas, Bermuda, Cuba, Jamaica, Puerto Rico, Virgin Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 14; Analspines: 4; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Small, chunky squirrelfish without a preopercular spine. Circumorbital bones have slender spines, those below eye forward-pointing (Ref. 26938). Body brilliant orangish red, fins somewhat paler. Spines near angle of preopercle somewhat enlarged. Soft dorsal, caudal and anal fins unscaled, their lobes broadly rounded (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 22 m (Ref. 40101)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 55 specimens in 1 taxon.
Water temperature and chemistry ranges based on 42 samples.

Environmental ranges
  Depth range (m): 0 - 1025
  Temperature range (°C): 7.090 - 27.717
  Nitrate (umol/L): 0.174 - 21.935
  Salinity (PPS): 34.447 - 36.594
  Oxygen (ml/l): 3.404 - 5.131
  Phosphate (umol/l): 0.036 - 1.415
  Silicate (umol/l): 0.885 - 14.234

Graphical representation

Depth range (m): 0 - 1025

Temperature range (°C): 7.090 - 27.717

Nitrate (umol/L): 0.174 - 21.935

Salinity (PPS): 34.447 - 36.594

Oxygen (ml/l): 3.404 - 5.131

Phosphate (umol/l): 0.036 - 1.415

Silicate (umol/l): 0.885 - 14.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Plectrypops retrospinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Plectrypops retrospinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACTGCCCTAAGCCTCCTCATCCGGGCTGAATTAAGCCAACCTGGAGCCCTTCTGGGAGATGATCAAATCTACAACGTTATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATAATCGGTGGCTTCGGAAACTGACTGATTCCTCTAATGATCGGCGCCCCCGACATGGCATTCCCTCGAATAAACAATATAAGCTTCTGACTTCTTCCCCCCTCCTTCCTCCTGTTATTAGCCTCCTCTGGAGTAGAAGCCGGAGCCGGGACAGGATGAACAGTATACCCGCCCCTGGCAGGAAACTTAGCACACGCAGGAGCTTCCGWTGATCTAACCATCTTTTCTCTTCACCTGRCAGGTATTTCCTCAATCCTAGGGGCCATTAATTTTATTACAACAATTATTAACATAAAACCCCCAGCTATTTCTCAATACCAAACACCTCTCTTTGTATGAGCTGTTCTAATCACAGCCGTACTTCTTCTCCTCTCCCTCCCCGTCCTTGCCGCCGGCATTACCATGCTCCTAACGGATCGAAATCTTAATACCACCTTCTTCGACCCATCTGGAGGAGGGGACCCCATTCTCTACCAGCACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!