Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in lagoon and seaward reefs. They are secretive species normally hidden in sand or rubble, sometimes with only its head protruding. Feed on small fishes (Ref. 9710, 48635, 75154). Juveniles all black, males have yellow dorsal fin and females change to a nearly all yellow color, but usually with blue in the posterior (Ref. 48635). Only moray that undergoes abrupt changes in coloration and sex: it is a protandrous hermaphrodite, i.e., functioning males reverse sex to become females. Protandry is diagnosed based on colouration, but not confirmed (Ref. 84746).
  • Chen, H.-M., K.-T. Shao and C.T. Chen 1994 A review of the muraenid eels (Family Muraenidae) from Taiwan with descriptions of twelve new records. Zool. Stud. 33(1):44-64. (Ref. 6934)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Rhinomuraena quaesita is distributed from East Africa to French Polynesia, north to southern Japan, and south to northwest and east coast Australia and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Tuamoto Islands, north to southern Japan, south to New Caledonia and French Polynesia; including Marianas and Marshalls.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Seychelles and western Mascarenes east to Mariana Islands and Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to Western Australia, Queensland (Australia) to 23°30'S and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0; Vertebrae: 270 - 286
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

130 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Has three fleshy tentacles on the tip of its lower jaw, a single fleshy pointed projection at the tip of its snout, and tubular anterior nostrils ending in gaudy, fanlike expansions.Description: Characterized by bright blue color with yellow dorsal fin and anterior part of head in male; yellow with black anal fin in female; black with yellow anal fin and white fin margins in juvenile and subadults; capable of male to female sex change; laterally compressed and extremely long body; depth at gill opening 65-75 in TL; origin of dorsal fin well foreward to gill opening, closer to corner of mouth; tail is longer than head and trunk; preanal length 3.0-3.3 in TL; large tubular anterior nostrils with greatly enlarged distal margin, forming fan-shaped appendage; front of upper jaw with forward-projecting slender barbel; three barbels at front of lower jaw; single row of small and slender jaw teeth that is slanted backwards (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Rhinomuraena quaesita can be found in lagoons and on coastal reef slopes. Although sometimes observed living in holes in the hard reef substrate, it is most commonly seen in sand or mud, or among coral rubble, sometimes with only its head protruding.

This species tends to be site attached; individuals have been known to stay in the same hole for months or even years. Juveniles are found individually, but it is not uncommon to find more than one male in the same area. In some cases, males will even share the same hole within the sandy substrate. During the day, individuals feed on small fishes that pass close to the burrow entrance.

Rhinomuraena quaesita has several characteristics that have lead experts to suggest that it should be placed in its own family — the Rhinomuraenidae; these include the positioning of its kidneys and most of its reproductive organs posterior to the anus (a unique condition that has not been reported in any other vertebrate) (Michael 1998).

This species is a protandrous hermaphrodite, i.e., all females are derived from males that have changed sex.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 67 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 7.5
  Temperature range (°C): 26.890 - 26.890
  Nitrate (umol/L): 0.139 - 0.139
  Salinity (PPS): 35.310 - 35.310
  Oxygen (ml/l): 4.636 - 4.636
  Phosphate (umol/l): 0.165 - 0.165
  Silicate (umol/l): 1.162 - 1.162

Graphical representation

Depth range (m): 1 - 7.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 57m.
From 1 to 57 meters.

Habitat: reef-associated. Occurs in lagoon and seaward reefs. Feeds on small fishes. Secretive species normally hidden in sand or rubble, sometimes with only its head protruding (Ref. 9710). Only moray that undergoes abrupt changes in coloration and sex: it is a protandrous hermaphrodite, i.e., functioning males reverse sex to become females.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in lagoon and seaward reefs. Common in Indonesia (Ref. 48635). Occurs in lagoon and seaward reefs. Feeds on small fishes (Ref. 6934). Secretive species normally hidden in sand or rubble, sometimes with only its head protruding (Ref. 9710, 48635). Juveniles all black, males have yellow dorsal fin and females change to a nearly all yellow color, but usually with blue in the posterior (Ref. 48635).
  • Chen, H.-M., K.-T. Shao and C.T. Chen 1994 A review of the muraenid eels (Family Muraenidae) from Taiwan with descriptions of twelve new records. Zool. Stud. 33(1):44-64. (Ref. 6934)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Protandry is diagnosed based on colouration, but not confirmed (Ref. 84746).
  • Fishelson, L. 1992 Comparative gonad morphology and sexuality of the Muraenidae (Pisces, Teleostei). Copeia 1992(1):197-209. (Ref. 32169)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinomuraena quaesita

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACAAACCATAAAGATATCGGCACCCTTTATTTAGTCTTTGGTGCTTGAGCCGGCATGGTTGGCACTGCATTGAGCCTTCTTATCCGGGCGGAGCTAAGCCAACCCGGGGCCCTTCTAGGTGACGACCAAATTTACAATGTTATCGTAACAGCCCACGCTTTTGTAATAATCTTTTTTATAGTGATACCAATTATAATTGGAGGTTTTGGAAACTGGCTTATTCCATTAATAATTGGGGCCCCAGACATGGCTTTTCCGCGCATAAATAACATAAGCTTCTGACTACTCCCCCCCTCATTTCTTTTACTTCTAGCCTCATCCGGCATTGAAGCGGGGGCAGGGACCGGCTGAACGGTTTACCCGCCCCTTGCAGGAAACCTGGCTCATGCCGGAGCATCTGTTGATCTAACGATCTTTTCCCTCCACCTTGCGGGTGTGTCATCAATCCTAGGTGCAATCAACTTTATTACAACTATTGTTAACATAAAACCCCCAGCCATTACTCAATACCAAACACCCTTATTTGTTTGAGCAGTGTTAGTCACAGCAGTGCTCCTCTTACTCTCTCTCCCAGTTCTAGCAGCTGGTATTACAATGCTTCTAACCGATCGAAACCTAAACACTACGTTCTTTGACCCTGCCGGAGGAGGTGACCCAATCCTATATCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTCTACATTTTAATCCTACCCGGGTTCGGAATGATTTCTCATATTGTTGCCTACTATGCTGGTAAACCTCAACCTTTTGGTTATATAGGGATGGTTTGAGCAATAATGGCAATTGGTCTGCTAGGCTTTATTGTGTGAGCCCACCATATATTTACAGTAGGAATAGATGTAGATACTCGAGCATATTTTACTTCAGCAACAATAATTATTGCGATCCCCACTGGAGTAAAAGTTTTTAGCTGACTTGCTACCCTTCATGGAGGCCAAATCAAATGAGAAACCCCATTACTCTGAGCCCTCGGCTTCATTTTTCTATTTACAGTTGGAGGCCTAACCGGAATCGTTCTAGCCAATTCATCTATTGATATTGTACTTCATGACACATATTATGTAGTAGCACACTTCCACTATGTTCTTTCTATGGGAGCTGTTTTTGCGAATATAGGAGGCTTCGTACATTGATTCCCCTTATTTACAGGCTACACTTTACATGACACTTGAACCAAAATCCATTTTGGGGTTATATTTATTGGGGTAAACCTTACCTTCTTCCCTCAACATTTCTTAGGTCTAGCAGGCATACCACGACGATACTCAGATTACCCCGATGCCTATACCCTATGAAACACCATCTCATCTATTGGCTCCTTGGTCTCTCTAACAGCTGTCATCTTATTCCTGTTTATTTTATGGGAGGCCTTTGCCTCAAAACGCGAAGTAAAATGGGTAGAACTAACCCCAACAAACGTCGAGTGACTTCATGGCTGCCCCCCTCCATATCATACATTTGAAGAACCAGGATACGTTCGTGTACATCCAGCCTGGGACTACAAATTTTGGGACACTAATCCTCTATATGGAAAAGTAGTTAAATACTCAAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinomuraena quaesita

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
McCosker, J.E.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Rhinomuraena quaesita has been assessed as Least Concern. This species has a very broad distribution and is reported to be common in parts of its range. While it is harvested for the aquarium trade, this is a localised threat only, and is not known throughout this species' broad range. At present, harvesting is unlikely to be significantly impacting the global population size.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rhinomuraena quaesita is reported to be common in Indonesia (Kuiter and Tonozuka 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is unlikely that Rhinomuraena quaesita is being impacted by any major threat processes. In Indonesia, this species is commercially harvested for the aquarium trade using cyanide fishing. However, this is a localised threat and not significant to the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Rhinomuraena quaesita. However, the distribution of this species may coincide with numerous marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ribbon eel

The ribbon eel, Rhinomuraena quaesita, or Bernis eel, is a species of moray eel, the only member of the genus Rhinomuraena. What is now known as Rhinomuraena quaesita also includes the former Rhinomuraena amboinensis. R. quaesita was used for blue ribbon eels and R. amboinensis for black ribbon eels, but these are now recognized as the same species,. The ribbon eel is native to the Indo-Pacific ocean.

The ribbon eel is an elegant creature bearing a resemblance to a mythical Chinese dragon with a long, thin body and high dorsal fins. The ribbon eel can easily be recognised by its expanded anterior nostrils. Juveniles and sub-adults are jet black with a yellow dorsal fin, while females are yellow with a black anal fin with white margins on the fins. The adult males are blue with a yellow dorsal fin.

The ribbon eel grows to an overall length of approximately 1 m (3.3 ft), and has a life span of up to twenty years.[citation needed] The ribbon eel is the only moray eel that is protandric.

In the aquarium[edit]

Because most ribbon eels do not live longer than a month in captivity, some feel that this species should never be purchased except for people with experience in keeping morays in captivity. Ribbon eels have been observed in many cases to stop eating after being captured, although there are reports of them surviving and eating in captivity for 2 years or more.[1]
With proper sized tanks, water flow, and depth of proper sand they can be kept for much longer in pairs. When keeping these it is critical that there is large amount of decor and large caves of rock or PVC piping to make them feel safe or else they will stress and die in the aforementioned manner. These morays can sometimes be able to be trained to eat inanimate foods by waving pieces of meat on snake feeding tongs. In some many cases fin-niping is a problem for obvious reasons.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!