Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults mainly inhabit coral reefs, sometimes forming large aggregations, which are mostly stationary during the day. Juveniles occur in seagrass beds, also in mixed sand and coral habitats of shallow sheltered reefs (Ref. 1602). Sub-adults commonly form very large schools that are stationary or drift slowly along slopes during the day. Large individuals along coastal slopes at moderate depths (Ref. 48635). Benthopelagic (Ref. 58302). Feed on fishes, and a variety of invertebrates including shrimps, crabs, lobsters, stomatopods, cephalopods, echinoderms and ophiuroids (Ref. 55).
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Line and Society islands, north to southern Japan, south to Australia.
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands and Line Islands (Kiribati), north to southern Japan, south to Western Australia, Queensland (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 13 - 14; Analspines: 3; Analsoft rays: 8
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 55)); max. reported age: 18 years (Ref. 2293)
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Dorsal profile of head steeply sloped. Preorbital bone broad, much wider than eye diameter. Preopercular notch and knob well developed. Scale rows on back rising obliquely, both above and below the lateral line. Generally red or gray, darker on back and upper portion of the head, with orange hue on the lower part of the opercle and in the pectoral axil. The fins are red, or frequently brown to blackish. The soft dorsal, caudal and anal fins have narrow white margins. Juveniles with a large, round, black spot at the base of the caudal fin (Ref. 55). Body depth 2.2-2.5 in SL (Ref. 90102).
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Mainly inhabits coral reefs, sometimes forming large aggregations, which are mostly stationary during the day. Juveniles occur in seagrass beds, also in mixed sand and coral habitats of shallow sheltered reefs (Ref. 1602). Feeds on fishes, and a variety of invertebrates including shrimps, crabs, lobsters, stomatopods, cephalopods, echinoderms and ophiuroids.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Anthias heraldi Schultz
Catalog Number: USNM 141964
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Kwajalein Atoll at lagoon reef located near southern end of Ennylabegan Island., Kwajalein Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1953. Bulletin of the United States National Museum. No. 202: 381, 61.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Anthias heraldi Schultz
Catalog Number: USNM 141963
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Kwajalein Atoll at lagoon reef located near southern end of Ennylabegan Island., Kwajalein Atoll, Ralik Chain, Marshall Islands, Pacific
  • Holotype: Schultz, L. P. 1953. Bulletin of the United States National Museum. No. 202: 381, 61.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 150 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 122 specimens in 1 taxon.
Water temperature and chemistry ranges based on 108 samples.

Environmental ranges
  Depth range (m): 0.55 - 100
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.026 - 2.589
  Salinity (PPS): 32.768 - 37.794
  Oxygen (ml/l): 4.080 - 4.727
  Phosphate (umol/l): 0.085 - 0.388
  Silicate (umol/l): 0.829 - 4.752

Graphical representation

Depth range (m): 0.55 - 100

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.026 - 2.589

Salinity (PPS): 32.768 - 37.794

Oxygen (ml/l): 4.080 - 4.727

Phosphate (umol/l): 0.085 - 0.388

Silicate (umol/l): 0.829 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 150m.
From 1 to 150 meters.

Habitat: reef-associated. Humpback snapper.  (Forsskal, 1775)  Attains 40 cm. Red Sea and tropical Indo-West Pacific south to Durban.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur inshore (Ref. 75154). Mainly inhabit coral reefs (Ref. 58652), sometimes forming large aggregations, which are mostly stationary during the day. Juveniles occur in seagrass beds (Ref. 41878), also in mixed sand and coral habitats of shallow sheltered reefs (Ref. 1602). Sub-adults commonly form very large schools that are stationary or drift slowly along slopes during the day. Large individuals along coastal slopes at moderate depths (Ref. 48635). Feed on fishes, and a variety of invertebrates including shrimps, crabs, lobsters, stomatopods, cephalopods, echinoderms and ophiuroids (Ref. 55).
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Hamacreadium Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cucullanus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Off East Africa spawning occurs mainly during spring and summer.
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus gibbus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTTGGTGCTTGAGCCGGAATGGTAGGCACAGCTCTAAGCCTACTCATTCGAGCAGAACTAAGCCAACCAGGAGCTCTTCTTGGAGACGACCAAATTTATAACGTAATCGTTACGGCACATGCGTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATTCCGTTAATAATCGGTGCCCCCGACATGGCATTCCCTCGAATAAATAATATGAGTTTTTGACTCCTTCCCCCATCCTTCCTGCTCCTGCTTGCTTCTTCTGGAGTAGAGGCTGGAGCCGGGACTGGATGAACGGTGTACCCTCCACTAGCAGGAAATCTTGCACACGCAGGGGCATCTGTTGATTTAACCATTTTCTCTCTTCACCTAGCAGGAGTTTCTTCAATTCTAGGGGCTATTAATTTTATCACAACCATTATCAACATGAAACCCCCTGCCATCTCACAATATCAAACACCCCTATTCGTTTGAGCTGTTCTAATTACTGCCGTCCTACTCCTTCTTTCCCTCCCAGTTTTAGCTGCTGGAATTACAATGCTTCTAACAGACCGAAACTTGAACACCACTTTCTTTGACCCAGCAGGAGGAGGTGATCCCATCCTCTACCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus gibbus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Joannot, P. 1997 List of fishes in the Noumea aquarium. Unpublished. (Ref. 13603)
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Humpback red snapper

The humpback red snapper or paddletail snapper, Lutjanus gibbus, is a species of snapper native to the Indian Ocean from the coast of Africa and the Red Sea to the western Pacific Ocean. It is mostly an inhabitant of coral reefs at depths of from 1 to 150 m (3.3 to 492.1 ft), with the juveniles being found in beds of seagrass or on sheltered coral reefs and subadults and adults found on sloping substrates. This species can reach a length of 50 cm (20 in). It is a commercially important species, as well as being sought after as a game fish. It is also a popular species for display in public aquaria. It has been reported to cause ciguatera poisoning.[1]

Synonyms[edit]

This species has been described under several names that are now agreed to as junior synonyms:

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Lutjanus gibbus" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!