Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coral heads of lagoon and seaward reefs; common in shallow caves or under ledges and can lie flat against vertical rock surfaces (Ref. 1602, 48637). Found in rubble slopes in sand or fine-rubble patches (Ref. 9792). Benthic (Ref. 58302). Comes out at dusk and hunts on low reef. It has low profile and crawls along like a flatworm, but activity waves its black pectoral fin as it goes (Ref. 48637). Feeds on small benthic animals (Ref. 9792).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: South Africa and East Africa east to Hawaiian Islands and Pitcairn Group, north to Izu Islands (southern Japan), south to Western Australia, Queensland (Australia), New Caledonia, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian and Society islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 64 - 70; Analspines: 0; Analsoft rays: 51 - 47; Vertebrae: 40 - 41
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 90 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body mottled brown with irregular dark and pale markings; 2-3 dark-edged ocelli along lateral line pectorals blackish distally; dorsal and anal fins with minute black dots; caudal fin with black spots (Ref. 6270). Gill rakers rudimentary (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Samariscus triocellatus
Catalog Number: USNM 167246
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): J. Randall et al.
Year Collected: 1951
Locality: Gilbert Islands: Onotoa Atoll, west reef about a mile or so north of Tabuarorae just to the lagoon side., Onotoa Atoll, Kiribati, Gilbert Islands, Pacific
Depth (m): 3
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Samariscus triocellatus
Catalog Number: USNM 141767
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Radiograph
Collector(s): V. Brock & L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Coral heads in eastern end of lagoon at depth 20 to 25 feet., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 9
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Samariscus triocellatus
Catalog Number: USNM 141768
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): V. Brock, E. Herald & T. Kohler
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll, near N(W)? end of Fongelap Island, lagoon side; single coral head in 18 ft water; (size of coral head---30'x30'x14 ft high), Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 1 to 5
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Samariscus triocellatus
Catalog Number: USNM 164421
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Gosline & Class
Year Collected: 1949
Locality: T.H., Oahu, Hanauma Bay, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 3 - 30m.
From 3 to 30 meters.

Habitat: reef-associated. Inhabits coral heads of lagoon and seaward reefs; common in shallow caves or under ledges and can lie flat against vertical rock surfaces (Ref. 1602). Feeds on small benthic animals (Ref. 9792).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 30 m (Ref. 11790)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0.5 - 80
  Temperature range (°C): 25.070 - 29.282
  Nitrate (umol/L): 0.025 - 1.248
  Salinity (PPS): 33.507 - 35.368
  Oxygen (ml/l): 4.387 - 4.802
  Phosphate (umol/l): 0.070 - 0.302
  Silicate (umol/l): 0.888 - 5.551

Graphical representation

Depth range (m): 0.5 - 80

Temperature range (°C): 25.070 - 29.282

Nitrate (umol/L): 0.025 - 1.248

Salinity (PPS): 33.507 - 35.368

Oxygen (ml/l): 4.387 - 4.802

Phosphate (umol/l): 0.070 - 0.302

Silicate (umol/l): 0.888 - 5.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral heads of lagoon and seaward reefs; common in shallow caves or under ledges and can lie flat against vertical rock surfaces. Feeds on small benthic animals.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Samariscus triocellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Samariscus triocellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACCTAATCTTTGGTGCCTGAGCAGGCATAGTAGGCACTGCCCTAAGCCTTTTAATCCGGACAGAACTGAGCCAACCAGGGGCCCTCCTCGGAGATGACCAAATTTATAATGTGATTGTAACTGCACATGCTTTTGTTATAATCTTCTTTATAGTTATACCTATTCTGATTGGAGGCTTTGGGAACTGACTTGTTCCTCTAATGATTGGAGCCCCTGATATAGCATTCCCTCGAATGAATAATATAAGCTTCTGACTTCTTCCTCCCTCATTCCTCCTCCTCCTTGCCTCTTCAGGAGTTGAAGCAGGAGCCGGCACAGGATGAACCGTATACCCCCCTTTAGCAAGTAATCTAGCCCATGCGGGGGCTTCTGTAGACCTAACCATCTTTTCACTTCACTTAGCAGGGGTCTCCTCAATCCTTGGCGCTATTAACTTCATTACAACCATTATTAACATGAAACCTGCTGCCGTTTCAATGTGCCAAATCCCTCTTTTCGTCTGATCTGTGCTTATTACAGCTATCTTGCTCCTTCTCTCTCTACCTGTGCTCGCCGCAGGAATTACAATACTTCTAACCGATCGAAATCTCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!