Overview

Brief Summary

Carassius auratus is a fairly small-sized member of the freshwater family Cyprinidae (carps and minnows), typically reaching about 22 cm long. There are several subspecies of C. auratus, all indigenous to Asia, including C. auratus argenteaphthalmus (Vietnam), C. auratus buergeri, C. auratus grandoculis, and C. auratus langsdorfii (Japan); however the best known subspecies is Carassius auratus auratus, the common domesticated goldfish. Carassius auratus is often confused with C. gibelio, the Prussian carp or Gibel carp, the wild species from which C. auratus was bred about 1000 years ago in China for aquaria, ornamental ponds and as a food fish. Like C. gibelio, wild C. auratus are a greenish color, omnivorous, live in slow-moving waters, and are hardy, even in non-native or slightly polluted/turbid environments. They have been introduced throughout the world, both intentionally and unintentionally, and in some places negatively impact their environment by competing with and preying on native species, causing increased incidence of algal blooms, and increasing water turbidity.

(Komiyama et al. 2009; Rowe 2010Wikipedia February 3, 2012; Wikipedia January 31 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Carassius auratus (Linnaeus, 1758)

Inland water: 27700-817 (2 spc.), 01.10.1997 , Istanbul Universty Department of Biology Pool , M. Ôzulug , C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 35-35, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabit rivers, lakes, ponds and ditches (Ref. 5258, 10294) with stagnant or slow-flowing water (Ref. 30578). Occur in eutrophic waters, well vegetated ponds and canals (Ref. 59043). Live better in cold water. Feed mainly on plankton, benthic invertebrates, plant material and detritus (Ref. 59043). Goldfish lay eggs on submerged vegetation. Females spawn multiple times during the spawning period (Ref. 88808). Oviparous, with pelagic larvae. They last long in captivity (Ref. 7248). Maximum recorded salinity is 17 ppt (Ref. 39171), but unable to withstand prolonged exposure above 15 ppt (Ref. 39172, 39174). Used as an experimental species (Ref. 4537). Valued as ornamental fish for ponds and aquaria; edible but rarely eaten (Ref. 9987). Aquarium keeping: in groups of 5 or more individuals; minimum aquarium size 100 cm (Ref. 51539). Reported individual hooked by an angler in a lake in Poole, Dorset measured 40 cm (16 in), weighing 2.3 kg (Practical Fishkeeping, 2010).
  • Kottelat, M., A.J. Whitten, S.N. Kartikasari and S. Wirjoatmodjo 1993 Freshwater fishes of Western Indonesia and Sulawesi. Periplus Editions, Hong Kong. 221 p. (Ref. 7050)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Although goldfishes originated in China, they have now spread worldwide in aquariums, ornamental pools, and into the wild.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species is reported to be native to East Asia: from the Amur River to the Pearl River basin including the Korean Peninsula and Taiwan (Freyhof and Kottelat 2007). It was domesticated in China more than 1,000 years ago, introduced to Japan in the 16th century and from Japan imported to Europe: Portugal 1611, England 1691 and France 1755. From then it was introduced throughout Europe and most of the world.

It was introduced throughout the world as the Asian form of the goldfish. Several countries report adverse ecological impact after introduction.

This is possibly the species (or Carassioides acuminatus) "Pa Fek" that has been introduced into the Nam Theun reservoir in Lao PDR where it has established very well.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: central Asia and China (Ref. 7050) and Japan (Ref. 6390). Introduced throughout the world. Asian form of the goldfish (Ref. 1739). Several countries report adverse ecological impact after introduction.
  • Kottelat, M., A.J. Whitten, S.N. Kartikasari and S. Wirjoatmodjo 1993 Freshwater fishes of Western Indonesia and Sulawesi. Periplus Editions, Hong Kong. 221 p. (Ref. 7050)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Eurasia. Introduced throughout U.S. and in parts of southern Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Although goldfishes originated in China, they have now spread worldwide in aquariums, ornamental pools, and into the wild.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

East Asia: China and Japan; introduced widely elsewhere; cultivated varieties.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

As there are over a hundred varieties of goldfish, coloration and physical characteristics vary greatly. The common goldfish has two sets of paired fins - the pectoral fins and pelvic fins, and three single fins- the dorsal, caudal, and anal fin. They lack barbels on the upper jaw, and lack scales on the head. Goldfish have exceptionally large eyes and acute senses of smell and hearing. They have 27-31 scales along their lateral lines. Goldfish have (rather than true teeth ) pharyngeal teeth in their throats which they use to crush food.

Goldfish can grow to be 3 kg and 45 cm long but are usually much smaller than this.

Range mass: 3.0 (high) kg.

Range length: 41.0 (high) cm.

Other Physical Features: bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

As there are over a hundred varieties of goldfish, coloration and physical characteristics vary greatly. The common goldfish has two sets of paired fins - the pectoral fins and pelvic fins, and three single fins- the dorsal, caudal, and anal fin. The head lacks scales. Goldfish have very large eyes and acute senses of smell and hearing. Instead of true teeth, goldfish have teeth in their throats which they use to crush food.

Range mass: 3.0 (high) kg.

Range length: 41.0 (high) cm.

Other Physical Features: bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 3 - 4; Dorsal soft rays (total): 14 - 20; Analspines: 2 - 3; Analsoft rays: 4 - 7; Vertebrae: 30
  • Jones, P.W., F.D. Martin and J.D. Hardy Jr. 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of eggs, larval and juvenile stages. Vol. 1. Acipenseridae through Ictaluridae. U.S. Fish Wildl. Ser. Biol. Serv. Program FWS/OBS-78/12. 336 p. (Ref. 4639)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 30 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 410 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

32.0 cm SL (male/unsexed; (Ref. 59043)); max. reported age: 41 years (Ref. 72468)
  • Bobick, J.E. and M. Peffer 1993 Science and technology desk reference. Gale Research Inc. (Ref. 72468)
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body stout, thick-set, caudal peduncle thick and short (Ref. 1998). Head without scales (Ref. 39167, 1998), broadly triangular (Ref. 1998), interorbital space broad, snout longer than eye diameter, maxillary reaching posterior nostril or not quite to eye (Ref. 39166), barbels lacking on upper jaw (Ref. 39104, 1998). Lateral line complete. Dorsal and anal fins with serrate bony spines, pelvic fins short, broad and thoracic. Nuptial tubercles of male fine, on opercle, sometimes on back and a few on pectoral fins. Hybridize readily with carp, hybrids intermediate in most characteristics (Ref. 1998). Caudal fin with 17-19 rays (Ref. 2196). Last simple anal ray osseous and serrated posteriorly; no barbels (Ref. 43281). Pigmentation: Wild-caught specimens, olive brown (Ref. 39168, 39104), slate olive, olive green, with a bronze sheen (Ref. 39104), silvery, grayish yellowish, gray-silver (Ref. 39169), through gold (often with black blotches) to creamy white (Ref. 1998); yellowish white or white below. Cultured forms vary through scarlet, red-pink, silver, brown, white, black and combinations of these colors (Ref. 39104).
  • Jones, P.W., F.D. Martin and J.D. Hardy Jr. 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of eggs, larval and juvenile stages. Vol. 1. Acipenseridae through Ictaluridae. U.S. Fish Wildl. Ser. Biol. Serv. Program FWS/OBS-78/12. 336 p. (Ref. 4639)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

In the wild, goldfish can be found in slow-moving, freshwater bodies of water. As with their close relative the carp, they thrive in slightely sludgy water. In an aquarium, bi-weekly water changes are a good idea as a goldfish tank is hard to keep clean. They thrive in a pond environment thus the addition of real plants is optimal if the owner is prepared to replace them fairly regularly; goldfish enjoy eating live plants. An aquarium with a dirt bottom is ideal but difficult to maintain. Small pebbles are a suitable substitute for the pond-like bottom. Typically, goldfish will survive in water temperatures ranging from freezing to 30 degrees centegrade. Fancy varieties(orandas, lionheads, ranchu, veiltailes...) should be kept in water no cooler than room temperature.

Goldfish prefer a pH range of 6.5-8.5.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits rivers, lakes, reservoirs, ponds and ditches (Man and Hodgkiss 1981, Etnier and Starnes 1993) with stagnant or slow-flowing water (Billard 1997). It occurs in eutrophic fresh and brackish waters, well vegetated ponds and canals (Kottelat and Freyhof 2007). The maximum recorded salinity is 17 ppt, but it is unable to withstand prolonged exposure above 15 ppt (Schwartz 1964). It feeds on a wide range of food including plants, small crustaceans, insects, and detritus (Kottelat and Freyhof 2007). The species usually lives up to about 20 years under artificial conditions.

It is oviparous, with pelagic larvae. It spawns when water temperatures reach 15-20 °C. Juveniles require high temperature to grow. Individual females spawn with a few males in dense vegetation. The eggs are sticky, attached to water plants or other submerged objectives.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Usually in still water with abundant vegetation: lakes, reservoirs, ponds, rivers, quiet streams. In clear or turbid water. Spawns in shallow water. Eggs are scattered and stick to objects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the wild, goldfish can be found in slow-moving, freshwater bodies of water. As with their close relative the carp, they thrive in slightly murky water. In captivity, an aquarium with live plants and a dirt bottom is ideal. Bi-weekly water changes are a good idea as a goldfish tank is hard to keep clean. Live plants must be replaced fairly regularly; goldfish enjoy eating them. Small pebbles are a suitable substitute for the pond-like bottom. Typically, goldfish will survive in water temperatures ranging from freezing to 30 degrees centegrade. Goldfish prefer a pH range of 6.5-8.5.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; pH range: 6.0 - 8.0; dH range: 5 - 19; depth range 0 - 20 m (Ref. 6898)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Shao, K.-T. and P.L. Lim 1991 Fishes of freshwater and estuary. Encyclopedia of field guide in Taiwan. Recreation Press, Co., Ltd., Taipei. vol. 31. 240 p. (in Chinese). (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 34 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.1 - 6
  Temperature range (°C): 7.970 - 7.970
  Nitrate (umol/L): 4.522 - 4.522
  Salinity (PPS): 32.029 - 32.029
  Oxygen (ml/l): 6.960 - 6.960
  Phosphate (umol/l): 0.673 - 0.673
  Silicate (umol/l): 3.669 - 3.669

Graphical representation

Depth range (m): 0.1 - 6
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In the wild, goldfish are omnivores. They eat plants, insects such as mosquito larvae, small crustaceans, zooplankton, and detritus.

In captivity, goldfish are commonly fed dried flake or pellet food. As pets, they should also be fed foods they would consume if they were in the wild. Good diet supplements include freeze dried Tubifex worms, mosquito larva, bloodworms, Daphnia, brineshrimp, and vegetation such as boiled peas and lettuce.

Primary Diet: carnivore (Eats non-insect arthropods); herbivore ; omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabit rivers, lakes, ponds and ditches (Ref. 5258, 10294) with stagnant or slow-flowing water (Ref. 30578). Benthopelagic (Ref. 58302). They live better in cold water. Maximum recorded salinity is 17 ppt (Ref. 39171), but unable to withstand prolonged exposure above 15 ppt (Ref. 39172, 39174). Goldfish prefer warm waters in lakes and slow flowing rivers (Ref. 30486). They usually live over soft, muddy river beds, in areas with soft submerged vegetation (Ref. 30486). Feed on a wide range of food including plants, small crustaceans, insects, and detritus (Ref. 5258, 10294). Feed on plants, insects, and detritus (Ref. 5258, 10411).Reported host of bodonid flagellate Cryptobia sp. (Ref. 26129).
  • Richardson, M.J., F.G. Whoriskey and L.H. Roy 1995 Turbidity generation and biological impacts of an exotic fish Carassius auratus, introduced into shallow seasonally anoxic ponds. J. Fish Biol. 47:576-585. (Ref. 10411)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats aquatic insects, molluscs, crustaceans, worms, and vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

In the wild, goldfish are omnivores. They eat plants, Insecta such as Culicidae larvae, small Malacostraca, zooplankton, and detritus (dead plant and animal matter found on the bottom).

In captivity, goldfish are commonly fed dried flake or pellet food. Good diet supplements include freeze dried Tubifex worms, Cuculidae, bloodworms, Daphnia magna, brineshrimp, and vegetation such as boiled peas and lettuce.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Just about anything that eats fish would eat goldfish.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Just about anything that eats fish would eat goldfish.

Known Predators:

  • great blue herons (Ardea_herodias)
  • green herons (Butorides_virescens)
  • ring-billed gulls (Larus_delawarensis)
  • belted kingfishers (Cercyle_alcyon)
  • turtles (Testudines)
  • northern pike (Esox_lucsius)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / pathogen
Aeromonas punctata infects Carassius auratus

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises scale of Carassius auratus

Animal / parasite / ectoparasite
colony of Ichthyophthirius multifilis ectoparasitises white spotted skin of Carassius auratus

Animal / parasite / ectoparasite
colony of Trichodina ectoparasitises gill of Carassius auratus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Carassius auratus is prey of:
Testudines
Stizostedion vitreum
Ardea herodias
Butorides virescens
Larus delawarensis
Ceryle alcyon

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Carassius auratus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

VHS (acute 1). Viral diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unspecified tumors. Neoplasia (tumors of unknown origin)
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Turbidity of the Skin (Freshwater fish). Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodinella Infection 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 4. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

SVC. Viral diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sporozoa-infection (Myxobolus sp.). Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skin Fungi (Saprolegnia sp.). Fungal diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myxobolus Infection 4. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Infectious ascites (Ornament.). Bacterial diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goldfish Iridovirus Infection 2. Viral diseases
  • Fijan, N. 1999 Spring viraemia of carp and other viral diseases and agents of warm-water fish. p.177-244. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goldfish Iridovirus Infection 1. Viral diseases
  • Fijan, N. 1999 Spring viraemia of carp and other viral diseases and agents of warm-water fish. p.177-244. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goldfish Herpesvirus 1. Viral diseases
  • Fijan, N. 1999 Spring viraemia of carp and other viral diseases and agents of warm-water fish. p.177-244. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fungal Infection (general). Fungal diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish tuberculosis (FishMB). Bacterial diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

False Fungal Infection (Apiosoma sp.). Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
  • Horne, M.T. and A.C. Barnes 1999 Enteric redmouth disease (Yersinia ruckeri). p.455-477. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cryptobia Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Congenital Deformities. Others
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columnaris Disease (l.). Bacterial diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columnaris Disease (e.). Bacterial diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coccidiosis (intestine). Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchorworm Disease (Lernaea sp.). Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchor worm Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aeromonosis. Bacterial diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Cold water temperatures during the winter months are necessary for proper ova development (Ref. 44091). Spawning takes place in shallow water among weeds, often where willow roots grow exposed in water (Ref. 39171), also meadows inundated by spring flood (Ref. 39176). Spawning activity begin just before dawn (Ref. 39168), to midafternoon (Ref. 39177). Individual fish spawn 3-10 lots of eggs at intervals of 8-10 days (Ref. 39180). Juveniles need high temperature to grow. Eggs are sticky, attached to water plants or submerged objects (Ref. 59043). Females spawn multiple times during the spawning period (Ref. 88808).
  • Jones, P.W., F.D. Martin and J.D. Hardy Jr. 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of eggs, larval and juvenile stages. Vol. 1. Acipenseridae through Ictaluridae. U.S. Fish Wildl. Ser. Biol. Serv. Program FWS/OBS-78/12. 336 p. (Ref. 4639)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Although there is one report of a pet goldfish who lived 43 years, 25 years is a more reasonable maximum lifespan for a goldfish kept in a pond. In an aquarium, ten years is more likely. In the wild, lifespan is undoubtedly less.

Range lifespan

Status: captivity:
25.0 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: wild:
41.0 years.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Although there is one report of a pet goldfish who lived 43 years, 25 years is a more reasonable maximum lifespan for a goldfish kept in a pond. In an aquarium, ten years is more likely. In the wild, lifespan is undoubtedly less.

Range lifespan

Status: captivity:
25.0 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: wild:
41.0 years.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 41 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Goldfish usually mature in their second year but this varies with diet, water temperature, and other environmental influences. In the wild, breeding occurs during the summer; breeding can occur year round in indoor aquariums. Mature female goldfish will become rounder during breeding; males develop tubercles (small bumps) on their heads, operculi, and pectoral fins. Males chase the females for several days before spawning occurs. Females can produce several thousand eggs per spawning period every 8 to 10 days. Eggs are not guarded. Goldfish eggs hatch in about 4-5 days at 18-20 degrees centegrade (64-68 degrees F.).

Breeding interval: Spawning may occur at intervals of 8 to 10 days.

Breeding season: summer

Average number of offspring: 10000.0.

Range gestation period: 5.0 (high) days.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in spring and summer. Produces several lots of eggs at intervals of 8-10 days. Eggs hatch in 2-14 days, depending on temperature. Sexually mature in 9 months to 3-4 years, depending on variety. Some European populations are gynogenetic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goldfish usually mature in their second year but this varies with diet, water temperature, and other environmental influences. In the wild, breeding occurs during the summer; breeding can occur year round in indoor aquariums. Mature female goldfish will become rounder during breeding; males develop small bumps on their heads, gill covers, and pectoral fins. Males chase the females for several days before spawning occurs. Females can produce several thousand eggs per spawning period up to several times every 8 to 10 days. Goldfish eggs hatch in about 4-5 days at 18-20 degrees centegrade(64-68 degrees F.).

Breeding interval: Spawning may occur at intervals of 8 to 10 days.

Breeding season: summer

Average number of offspring: 10000.0.

Range time to hatching: 5.0 (high) days.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Hunting in murky water: goldfish
 

Goldfish can hunt in murky environments because they are able to detect far-red and infrared light.

     
  "Like the piranha, the goldfish often inhabits murky, vegetation-choked stretches of freshwater in its natural habitat. It has therefore adapted so that it is able to detect far-red light. Indeed, its visual range exceeds that of the piranha because it can see beyond far-red light, into true infrared." (Shuker 2001:19)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carassius auratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCTTTAAGCCTCCTCATCCGAGCTGAACTTAGTCAACCCGGATCACTTCTAGGTGATGACCAAATTTACAATGTAATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATCCTAATTGGAGGATTCGGAAACTGACTCGTACCCCTGATAATTGGAGCCCCAGACATGGCATTCCCACGAATAAATAATATAAGCTTTTGACTTCTTCCCCCATCATTCCTGCTACTGCTAGCTTCTTCTGGTGTTGAAGCCGGAGCTGGCACCGGATGAACAGTATACCCCCCTCTTGCAGGAAACCTGGCCCACGCAGGAGCATCAGTAGACCTAACAATTTTCTCACTACATTTAGCAGGTGTTTCATCAATCCTTGGGGCAATCAACTTCATTACTACAACTATTAACATAAAACCTCCAGCCATCTCCCAGTACCAAACACCCCTATTTGTTTGATCCGTACTTGTAACCGCCGTTCTCCTTCTCCTATCACTACCTGTCCTGGCTGCCGGTATTACAATGCTTTTAACAGATCGAAATCTCAACACCACATTCTTTGATCCCGCAGGCGGGGGAGACCCAATCCTCTACCAACACTTATTCTGATTCTTTGGTCACCCGGAAGTTTATATTTTAATCCTTCCAGGATTTGGAATTATTTCTCACGTTGTAGCCTACTATTCAGGTAAAAAAGAACCATTTGGCTATATGGGAATAGTATGAGCCATAATGGCCATTGGCCTCCTAGGGTTCATTGTATGAGCCCACCATATGTTTACTGTCGGAATGGACGTAGACACCCGTGCATATTTTACATCCGCAACAATAATCATCGCAATTCCAACAGGTGTAAAAGTATTTAGCTGATTAGCCACACTTCATGGAGGATCAATCAAATGAGAAACACCAATACTATGAGCCCTGGGATTCATCTTCCTATTTACAGTAGGAGGACTTACAGGAATTGTCCTCTCTAATTCATCACTTGACATTGTCCTTCACGACACCTATTATGTAGTAGCACATTTCCACTATGTACTATCAATGGGTGCTGTATTCGCCATTATGGCAGCCTTTGTACACTGATTCCCTCTATTAACAGGTTACACCCTACATAGCGCTTGAACAAAAATCCACTTTGGAGTTATATTTATTGGAGTCAACCTCACATTCTTCCCACAACACTTCCTAGGCCTAGCAGGAATACCACGACGATATTCTGACTATCCAGACGCTTATGCCCTATGAAACACAGTATCATCTATTGGATCTCTAATCTCCCTAGTAGCGGTAATTATGTTCCTATTTATTCTATGAGAAGCCTTCGCCGCTAAACGAGAAGTGCTATCTGTAGAACTAACAATAACAAATGTGGAATGACTCCATGGCTGCCCCCCTCCTTACCACACATACGAGGAACCAGCATTTGTTCAAATTCAATCAAATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carassius auratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 56
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Carassius auratus ssp Pingxiang

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carassius auratus ssp Pingxiang

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Goldfish are not in the least bit endangered.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Huckstorf, V. & Freyhof, J.

Reviewer/s
Ng, H.H., Kullander, S.O., Rainboth, W., Baird, I. & Allen, D.

Contributor/s

Justification
The species is assessed as Least Concern as it has a large distribution area and there are no known widespread threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goldfish are quite abundant.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no information available on the species' population within its natural distribution range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No threats to this species are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Introduced populations are due primarily to people releasing their pets into local waterways. Goldfish should not be released into ponds in the wild because they breed quickly and are capable of crowding out native fish species. They are considered pests in most places where they have been introduced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goldfish farming has become an industry of notable size. Millions of fish are bred each year and sold to aquarium shops for resale to fish enthusiasts. In North America there is a demand for goldfish to be used as bait by anglers. Pet shops often have feeder goldfish to sell to owners of carnivorous aquarium fish.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Popular aquarium fish. One of the most intensively cultured bait fishes in U.S. Important source of food in Asia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Introduced populations are due primarily to people releasing their pets into local waterways. Goldfish should not be released into ponds in the wild because they breed quickly and are capable of crowding out native fish species. They are considered pests in most places where they have been introduced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Goldfish farming has become an industry of notable size. Millions of fish are bred each year and sold to aquarium shops for resale to fish enthusiasts. In North America there is a demand for goldfish to be used as bait by anglers. Pet shops often have feeder goldfish to sell to owners of carnivorous aquarium fish.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes; aquarium: highly commercial; bait: occasionally
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Frimodt, C. 1995 Multilingual illustrated guide to the world's commercial warmwater fish. Fishing News Books, Osney Mead, Oxford, England. 215 p. (Ref. 9987)
  • Courtenay, W.R. Jr. and J.R. Stauffer Jr. 1990 The introduced fish problem and the aquarium fish industry. J. World Aquacult. Soc. 21:145-159. (Ref. 4709)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Sometimes has been included in CARASSIUS CARASSIUS. Readily hybridizes and backcrosses with carp (CYPRINUS CARPIO) in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!