Overview

Brief Summary

Carassius auratus is a fairly small-sized member of the freshwater family Cyprinidae (carps and minnows), typically reaching about 22 cm long. There are several subspecies of C. auratus, all indigenous to Asia, including C. auratus argenteaphthalmus (Vietnam), C. auratus buergeri, C. auratus grandoculis, and C. auratus langsdorfii (Japan); however the best known subspecies is Carassius auratus auratus, the common domesticated goldfish. Carassius auratus is often confused with C. gibelio, the Prussian carp or Gibel carp, the wild species from which C. auratus was bred about 1000 years ago in China for aquaria, ornamental ponds and as a food fish. Like C. gibelio, wild C. auratus are a greenish color, omnivorous, live in slow-moving waters, and are hardy, even in non-native or slightly polluted/turbid environments. They have been introduced throughout the world, both intentionally and unintentionally, and in some places negatively impact their environment by competing with and preying on native species, causing increased incidence of algal blooms, and increasing water turbidity.

(Komiyama et al. 2009; Rowe 2010Wikipedia February 3, 2012; Wikipedia January 31 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Carassius auratus (Linnaeus, 1758)

Inland water: 27700-817 (2 spc.), 01.10.1997 , Istanbul Universty Department of Biology Pool , M. Ôzulug , C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 35-35, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to Eurasia. Introduced throughout U.S. and in parts of southern Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The species is reported to be native to East Asia: from the Amur River to the Pearl River basin including the Korean Peninsula and Taiwan (Freyhof and Kottelat 2007). It was domesticated in China more than 1,000 years ago, introduced to Japan in the 16th century and from Japan imported to Europe: Portugal 1611, England 1691 and France 1755. From then it was introduced throughout Europe and most of the world.

It was introduced throughout the world as the Asian form of the goldfish. Several countries report adverse ecological impact after introduction.

This is possibly the species (or Carassioides acuminatus) "Pa Fek" that has been introduced into the Nam Theun reservoir in Lao PDR where it has established very well.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Although goldfishes originated in China, they have now spread worldwide in aquariums, ornamental pools, and into the wild.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Although goldfishes originated in China, they have now spread worldwide in aquariums, ornamental pools, and into the wild.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Asia: China and Japan; introduced widely elsewhere; cultivated varieties.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As there are over a hundred varieties of goldfish, coloration and physical characteristics vary greatly. The common goldfish has two sets of paired fins - the pectoral fins and pelvic fins, and three single fins- the dorsal, caudal, and anal fin. The head lacks scales. Goldfish have very large eyes and acute senses of smell and hearing. Instead of true teeth, goldfish have teeth in their throats which they use to crush food.

Range mass: 3.0 (high) kg.

Range length: 41.0 (high) cm.

Other Physical Features: bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

As there are over a hundred varieties of goldfish, coloration and physical characteristics vary greatly. The common goldfish has two sets of paired fins - the pectoral fins and pelvic fins, and three single fins- the dorsal, caudal, and anal fin. They lack barbels on the upper jaw, and lack scales on the head. Goldfish have exceptionally large eyes and acute senses of smell and hearing. They have 27-31 scales along their lateral lines. Goldfish have (rather than true teeth ) pharyngeal teeth in their throats which they use to crush food.

Goldfish can grow to be 3 kg and 45 cm long but are usually much smaller than this.

Range mass: 3.0 (high) kg.

Range length: 41.0 (high) cm.

Other Physical Features: bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 30 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 410 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Usually in still water with abundant vegetation: lakes, reservoirs, ponds, rivers, quiet streams. In clear or turbid water. Spawns in shallow water. Eggs are scattered and stick to objects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits rivers, lakes, reservoirs, ponds and ditches (Man and Hodgkiss 1981, Etnier and Starnes 1993) with stagnant or slow-flowing water (Billard 1997). It occurs in eutrophic fresh and brackish waters, well vegetated ponds and canals (Kottelat and Freyhof 2007). The maximum recorded salinity is 17 ppt, but it is unable to withstand prolonged exposure above 15 ppt (Schwartz 1964). It feeds on a wide range of food including plants, small crustaceans, insects, and detritus (Kottelat and Freyhof 2007). The species usually lives up to about 20 years under artificial conditions.

It is oviparous, with pelagic larvae. It spawns when water temperatures reach 15-20 °C. Juveniles require high temperature to grow. Individual females spawn with a few males in dense vegetation. The eggs are sticky, attached to water plants or other submerged objectives.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the wild, goldfish can be found in slow-moving, freshwater bodies of water. As with their close relative the carp, they thrive in slightly murky water. In captivity, an aquarium with live plants and a dirt bottom is ideal. Bi-weekly water changes are a good idea as a goldfish tank is hard to keep clean. Live plants must be replaced fairly regularly; goldfish enjoy eating them. Small pebbles are a suitable substitute for the pond-like bottom. Typically, goldfish will survive in water temperatures ranging from freezing to 30 degrees centegrade. Goldfish prefer a pH range of 6.5-8.5.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the wild, goldfish can be found in slow-moving, freshwater bodies of water. As with their close relative the carp, they thrive in slightely sludgy water. In an aquarium, bi-weekly water changes are a good idea as a goldfish tank is hard to keep clean. They thrive in a pond environment thus the addition of real plants is optimal if the owner is prepared to replace them fairly regularly; goldfish enjoy eating live plants. An aquarium with a dirt bottom is ideal but difficult to maintain. Small pebbles are a suitable substitute for the pond-like bottom. Typically, goldfish will survive in water temperatures ranging from freezing to 30 degrees centegrade. Fancy varieties(orandas, lionheads, ranchu, veiltailes...) should be kept in water no cooler than room temperature.

Goldfish prefer a pH range of 6.5-8.5.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 34 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.1 - 6
  Temperature range (°C): 7.970 - 7.970
  Nitrate (umol/L): 4.522 - 4.522
  Salinity (PPS): 32.029 - 32.029
  Oxygen (ml/l): 6.960 - 6.960
  Phosphate (umol/l): 0.673 - 0.673
  Silicate (umol/l): 3.669 - 3.669

Graphical representation

Depth range (m): 0.1 - 6
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats aquatic insects, molluscs, crustaceans, worms, and vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In the wild, goldfish are omnivores. They eat plants, Insecta such as Culicidae larvae, small Malacostraca, zooplankton, and detritus (dead plant and animal matter found on the bottom).

In captivity, goldfish are commonly fed dried flake or pellet food. Good diet supplements include freeze dried Tubifex worms, Cuculidae, bloodworms, Daphnia magna, brineshrimp, and vegetation such as boiled peas and lettuce.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In the wild, goldfish are omnivores. They eat plants, insects such as mosquito larvae, small crustaceans, zooplankton, and detritus.

In captivity, goldfish are commonly fed dried flake or pellet food. As pets, they should also be fed foods they would consume if they were in the wild. Good diet supplements include freeze dried Tubifex worms, mosquito larva, bloodworms, Daphnia, brineshrimp, and vegetation such as boiled peas and lettuce.

Primary Diet: carnivore (Eats non-insect arthropods); herbivore ; omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Just about anything that eats fish would eat goldfish.

Known Predators:

  • great blue herons (Ardea_herodias)
  • green herons (Butorides_virescens)
  • ring-billed gulls (Larus_delawarensis)
  • belted kingfishers (Cercyle_alcyon)
  • turtles (Testudines)
  • northern pike (Esox_lucsius)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Animal / pathogen
Aeromonas punctata infects Carassius auratus

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises scale of Carassius auratus

Animal / parasite / ectoparasite
colony of Ichthyophthirius multifilis ectoparasitises white spotted skin of Carassius auratus

Animal / parasite / ectoparasite
colony of Trichodina ectoparasitises gill of Carassius auratus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Just about anything that eats fish would eat goldfish.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Carassius auratus is prey of:
Testudines
Stizostedion vitreum
Ardea herodias
Butorides virescens
Larus delawarensis
Ceryle alcyon

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Carassius auratus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Although there is one report of a pet goldfish who lived 43 years, 25 years is a more reasonable maximum lifespan for a goldfish kept in a pond. In an aquarium, ten years is more likely. In the wild, lifespan is undoubtedly less.

Range lifespan

Status: captivity:
25.0 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: wild:
41.0 years.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Although there is one report of a pet goldfish who lived 43 years, 25 years is a more reasonable maximum lifespan for a goldfish kept in a pond. In an aquarium, ten years is more likely. In the wild, lifespan is undoubtedly less.

Range lifespan

Status: captivity:
25.0 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: wild:
41.0 years.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 41 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawns in spring and summer. Produces several lots of eggs at intervals of 8-10 days. Eggs hatch in 2-14 days, depending on temperature. Sexually mature in 9 months to 3-4 years, depending on variety. Some European populations are gynogenetic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goldfish usually mature in their second year but this varies with diet, water temperature, and other environmental influences. In the wild, breeding occurs during the summer; breeding can occur year round in indoor aquariums. Mature female goldfish will become rounder during breeding; males develop small bumps on their heads, gill covers, and pectoral fins. Males chase the females for several days before spawning occurs. Females can produce several thousand eggs per spawning period up to several times every 8 to 10 days. Goldfish eggs hatch in about 4-5 days at 18-20 degrees centegrade(64-68 degrees F.).

Breeding interval: Spawning may occur at intervals of 8 to 10 days.

Breeding season: summer

Average number of offspring: 10000.0.

Range time to hatching: 5.0 (high) days.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goldfish usually mature in their second year but this varies with diet, water temperature, and other environmental influences. In the wild, breeding occurs during the summer; breeding can occur year round in indoor aquariums. Mature female goldfish will become rounder during breeding; males develop tubercles (small bumps) on their heads, operculi, and pectoral fins. Males chase the females for several days before spawning occurs. Females can produce several thousand eggs per spawning period every 8 to 10 days. Eggs are not guarded. Goldfish eggs hatch in about 4-5 days at 18-20 degrees centegrade (64-68 degrees F.).

Breeding interval: Spawning may occur at intervals of 8 to 10 days.

Breeding season: summer

Average number of offspring: 10000.0.

Range gestation period: 5.0 (high) days.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Hunting in murky water: goldfish
 

Goldfish can hunt in murky environments because they are able to detect far-red and infrared light.

     
  "Like the piranha, the goldfish often inhabits murky, vegetation-choked stretches of freshwater in its natural habitat. It has therefore adapted so that it is able to detect far-red light. Indeed, its visual range exceeds that of the piranha because it can see beyond far-red light, into true infrared." (Shuker 2001:19)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carassius auratus ssp Pingxiang

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carassius auratus ssp Pingxiang

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Carassius auratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCTTTAAGCCTCCTCATCCGAGCTGAACTTAGTCAACCCGGATCACTTCTAGGTGATGACCAAATTTACAATGTAATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATCCTAATTGGAGGATTCGGAAACTGACTCGTACCCCTGATAATTGGAGCCCCAGACATGGCATTCCCACGAATAAATAATATAAGCTTTTGACTTCTTCCCCCATCATTCCTGCTACTGCTAGCTTCTTCTGGTGTTGAAGCCGGAGCTGGCACCGGATGAACAGTATACCCCCCTCTTGCAGGAAACCTGGCCCACGCAGGAGCATCAGTAGACCTAACAATTTTCTCACTACATTTAGCAGGTGTTTCATCAATCCTTGGGGCAATCAACTTCATTACTACAACTATTAACATAAAACCTCCAGCCATCTCCCAGTACCAAACACCCCTATTTGTTTGATCCGTACTTGTAACCGCCGTTCTCCTTCTCCTATCACTACCTGTCCTGGCTGCCGGTATTACAATGCTTTTAACAGATCGAAATCTCAACACCACATTCTTTGATCCCGCAGGCGGGGGAGACCCAATCCTCTACCAACACTTATTCTGATTCTTTGGTCACCCGGAAGTTTATATTTTAATCCTTCCAGGATTTGGAATTATTTCTCACGTTGTAGCCTACTATTCAGGTAAAAAAGAACCATTTGGCTATATGGGAATAGTATGAGCCATAATGGCCATTGGCCTCCTAGGGTTCATTGTATGAGCCCACCATATGTTTACTGTCGGAATGGACGTAGACACCCGTGCATATTTTACATCCGCAACAATAATCATCGCAATTCCAACAGGTGTAAAAGTATTTAGCTGATTAGCCACACTTCATGGAGGATCAATCAAATGAGAAACACCAATACTATGAGCCCTGGGATTCATCTTCCTATTTACAGTAGGAGGACTTACAGGAATTGTCCTCTCTAATTCATCACTTGACATTGTCCTTCACGACACCTATTATGTAGTAGCACATTTCCACTATGTACTATCAATGGGTGCTGTATTCGCCATTATGGCAGCCTTTGTACACTGATTCCCTCTATTAACAGGTTACACCCTACATAGCGCTTGAACAAAAATCCACTTTGGAGTTATATTTATTGGAGTCAACCTCACATTCTTCCCACAACACTTCCTAGGCCTAGCAGGAATACCACGACGATATTCTGACTATCCAGACGCTTATGCCCTATGAAACACAGTATCATCTATTGGATCTCTAATCTCCCTAGTAGCGGTAATTATGTTCCTATTTATTCTATGAGAAGCCTTCGCCGCTAAACGAGAAGTGCTATCTGTAGAACTAACAATAACAAATGTGGAATGACTCCATGGCTGCCCCCCTCCTTACCACACATACGAGGAACCAGCATTTGTTCAAATTCAATCAAATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carassius auratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 56
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Huckstorf, V. & Freyhof, J.

Reviewer/s
Ng, H.H., Kullander, S.O., Rainboth, W., Baird, I. & Allen, D.

Contributor/s

Justification
The species is assessed as Least Concern as it has a large distribution area and there are no known widespread threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goldfish are quite abundant.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goldfish are not in the least bit endangered.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no information available on the species' population within its natural distribution range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No threats to this species are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Popular aquarium fish. One of the most intensively cultured bait fishes in U.S. Important source of food in Asia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Introduced populations are due primarily to people releasing their pets into local waterways. Goldfish should not be released into ponds in the wild because they breed quickly and are capable of crowding out native fish species. They are considered pests in most places where they have been introduced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Goldfish farming has become an industry of notable size. Millions of fish are bred each year and sold to aquarium shops for resale to fish enthusiasts. In North America there is a demand for goldfish to be used as bait by anglers. Pet shops often have feeder goldfish to sell to owners of carnivorous aquarium fish.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Introduced populations are due primarily to people releasing their pets into local waterways. Goldfish should not be released into ponds in the wild because they breed quickly and are capable of crowding out native fish species. They are considered pests in most places where they have been introduced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Goldfish farming has become an industry of notable size. Millions of fish are bred each year and sold to aquarium shops for resale to fish enthusiasts. In North America there is a demand for goldfish to be used as bait by anglers. Pet shops often have feeder goldfish to sell to owners of carnivorous aquarium fish.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Sometimes has been included in CARASSIUS CARASSIUS. Readily hybridizes and backcrosses with carp (CYPRINUS CARPIO) in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!