Overview

Comprehensive Description

Sardina pilchardus (Walbaum, 1792)

Sea of Marmara : 3900-675 (3 spc.), 17.04.1992 , western waters of Imrali Island , trawl , 33 m, L. Eryilmaz ; 3900-676 (1 spc.), 15.07.1995 , Front of Goenen Stream , trawl , 28 m, L. Eryilmaz . Inland water: 3900-56 (1 spc.), 01.09.1977 , Kuecuekcekmece Lagoon , Istanbul , N. Meriç ; 3900-68 (6 spc.), 01.09.1977 , Kuecuekcekmece Lagoon , Istanbul , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 34-34, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Littoral species (Ref. 6808). Form schools, usually at depths of 25 to 55 or even 100 m by day, rising to 10 to 35 m at night. Feed mainly on planktonic crustaceans, also on larger organisms. Spawn in batches (Ref. 51846), in the open sea or near the coast, producing 50,000-60,000 eggs with a mean diameter of 1.5 mm (Ref. 35388). Marketed fresh, frozen or canned. Also utilized dried or salted and smoked; can be pan-fried, broiled and microwaved (Ref. 9988).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northeast Atlantic: Iceland (rare) and North Sea, southward to Bay de Gorée, Senegal. Mediterranean (common in the western part and in Adriatic Sea, rare in the eastern part), Sea of Marmara and Black Sea.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean Sea, Black Sea, eastern Atlantic: Iceland to Senegal including Madeira and Canary Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 21; Analspines: 0; Analsoft rays: 12 - 23
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

27.5 cm SL (male/unsexed; (Ref. 74552)); max. reported age: 15 years (Ref. 35388)
  • Muus, B.J. and J.G. Nielsen 1999 Sea fish. Scandinavian Fishing Year Book, Hedehusene, Denmark. 340 p. (Ref. 35388)
  • Macer, C.T. 1974 Some observations on the fecundity of the pilchard (Sardino pilchardus Walbaum) off the south-west coast of England. ICES: C.M. J(9):11p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body sub-cylindrical, belly rather rounded (but more compressed in juveniles). Hind margin of gill opening smoothly rounded (without fleshy outgrowths) ; 3 to 5 distinct body striae radiating downward on lower part of operculum; lower gill rakers not becoming shorter at angle of first gill arch, the upper series not overlapping the lower. Last 2 anal fin rays enlarged.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; oceanodromous (Ref. 51243); freshwater; brackish; marine; depth range 10 - 100 m (Ref. 5286), usually 25 - 100 m (Ref. 54866)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Whitehead, P.J.P. 1990 Clupeidae. p. 208-227. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 5286)
  • FAO-FIGIS 2005 A world overview of species of interest to fisheries. Chapter: Sardina pilchardus. Retrieved on 08 July 2005, from www.fao.org/figis/servlet/species?fid=2910. 3p. FIGIS Species Fact Sheets. Species Identification and Data Programme-SIDP, FAO-FIGIS (Ref. 54866)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4404 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3229 samples.

Environmental ranges
  Depth range (m): -9 - 364
  Temperature range (°C): 6.433 - 17.600
  Nitrate (umol/L): 0.729 - 14.675
  Salinity (PPS): 30.162 - 38.232
  Oxygen (ml/l): 4.715 - 6.451
  Phosphate (umol/l): 0.096 - 0.837
  Silicate (umol/l): 1.624 - 10.823

Graphical representation

Depth range (m): -9 - 364

Temperature range (°C): 6.433 - 17.600

Nitrate (umol/L): 0.729 - 14.675

Salinity (PPS): 30.162 - 38.232

Oxygen (ml/l): 4.715 - 6.451

Phosphate (umol/l): 0.096 - 0.837

Silicate (umol/l): 1.624 - 10.823
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 100m.
From 10 to 100 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Undergoes diel vertical migration, going deeper during the day and rising near the surface at night. Littoral species (Ref. 6808). Spawn in the open sea or near the coast, producing 50,000-60,000 eggs with a diameter of 1.5 mm (Ref. 35388). Forms schools, usually at depths of 25 to 55 or even 100 m by day, rising to 10 to 35 m at night. Feeds mainly on planktonic crustaceans, also on larger organisms. Stomach fullness and color indices were used to determine feeding intensity and food quality of juveniles and adult sardines (Ref. 55906).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Sardina pilchardus is prey of:
Conger conger
Dicentrarchus labrax
Aves

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Sardina pilchardus preys on:
Mysidacea
Copepoda

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Breeds at 20 to 25 m, near the shore or as much as 100 km out to sea.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sardina pilchardus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCGACTAATCATAAAGATATTGGCACCCTCTACCTAGTGTTTGGTGCCTGAGCAGGGATGGTGGGCACTGCCCTGAGTCTTCTGATCCGAGCAGAACTTAGCCAACCCGGGGCACTTCTCGGTGAT---GATCAGATTTATAACGTAATCGTTACCGCGCACGCCTTTGTGATGATCTTTTTCATGGTTATGCCAATCCTGATTGGCGGCTTTGGAAACTGACTAGTTCCTCTTATGATCGGAGCACCTGATATGGCATTCCCACGAATGAATAACATGAGCTTCTGGCTACTTCCCCCCTCATTCCTTCTCCTCCTTGCCTCATCAGGGGTAGAGGCGGGGGCAGGAACGGGGTGGACTGTCTACCCCCCTCTGTCAGGCAATCTGGCACATGCCGGAGCGTCAGTTGATCTCACTATTTTCTCACTACACCTTGCTGGTATCTCCTCAATTCTTGGGGCTATCAATTTTATTACCACAATTATCAACATGAAGCCTCCGGCAATCTCGCAATACCAAACACCCCTGTTCGTGTGGTCCGTGCTGGTGACAGCTGTTCTTCTTCTTCTTTCACTCCCTGTCTTGGCTGCCGGGATCACAATGCTTCTCACAGACCGAAATCTTAACACAACCTTCTTCGACCCCGCTGGAGGAGGAGATCCCATTCTGTATCAGCACCTATTCTGATTCTTTGGCCACCCAGAGGTTTACATTTTAATTCTTCCGGGGTTCGGTATGATCTCCCACATTGTAGCCTACCACGCCGGCAAAAAAGAGCCTTTTGGCTACATAGGAATGGTGTGGGCTATGATGGCCATCGGATTGCTCGGGTTTATTGTATGAGCCCACCACATGTTTACAGTAGGGATGGATGTTGACACACGGGGCTATTTTACATCTGCAACAATGATCATTGCCATCCCAACCGGGGTTAAGGTCTTTAGCTGACTTGCAACGCTACATGGAGGC---TCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sardina pilchardus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 65
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: low; price reliability: reliable: based on ex-vessel price for this species
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European pilchard

European pilchard (Sardina pilchardus) is a species of ray-finned fish in the monotypic genus Sardina. Littoral species. Forms schools, usually at depths of 25 to 55 or even 100 m by day, rising to 10 to 35 m at night. Feeds mainly on planktonic crustaceans, also on larger organisms. Spawns in batches, in the open sea or near the coast, producing 50,000-60,000 eggs with a mean diameter of 1.5 mm.

Footnotes

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!