Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: unicornfish (English), pez-unicornio (Espanol)
 
Naso annulatus (Quoy & Gaimard, 1825)


White-margin unicornfish


Body elongate, oval; snout pointed, slopes at about 60°; adult with long, tapering horn before eye that can extend 1 head length forward (a bump on forehead of juveniles); mouth small, protrusible, low on head; teeth small, conical, tips slightly depressed & either smooth or with multiple small points; dorsal fin VI, 28-29; anal II, 27-28; pectoral 17-19 rays; pelvics I, 3; 2 pairs of cutting keels on plates on narrow tail base; tail edge straight, a series of small scallops on rear margin, long filaments from top and bottom in males (straight in juveniles); scales very small, rough; lateral line complete.

Olive to brown; can switch on pale blue color; tail with wide rays blackish, membranes between rays, narrow margin, and filaments white. Juvenile with thin white dorsal and anal margins, a white saddle on the caudal peduncle, tail dark with white margin.

        Size: 100 cm.

        Habitat: juveniles and subadults benthic on reefs and rocky shores, adults in open water near exposed reef fronts.

Depth: 0-122 m; subadults usually 5-15 m, adults usually 10-30 m.

An Indo-Pacific species recorded as a vagrant from Cocos and Clipperton Atoll.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Juveniles occur in clear, shallow lagoon reefs at depths as little as 1 m; adults rarely seen in less than 25 m, encountered off outer reef drop-offs in small schools (Ref. 30573, 48637). Benthopelagic (Ref. 58302). Feeds on large zooplankton during the day and shelter within the reef during the night; also benthic algae (Ref. 30573, 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Naso annulatus is widespread in the Indo-Pacific and is found from the Red Sea to Natal, eastwards to the Hawaiian Island, Tuamotu Archipelago and Marquesas, northwards to Honshu, Japan, southwards to Lord Howe Island and Norfolk Island. It is also found in the eastern Pacific from Clipperton Island (Robertson and Allen 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to the Hawaiian, Marquesan, and Tuamoto islands, north to southern Japan, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, Oman, Madagascar, Seychelles and Mascarenes east to Hawaiian Islands, Marquesas Islands and Gambier Islands, north to southern Japan, south to Western Australia, Queensland (Australia), New Caledonia, Lord Howe Island,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 122 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 5; Dorsal soft rays (total): 28 - 29; Analspines: 2; Analsoft rays: 27 - 28
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 100.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Juveniles occur in clear, shallow lagoon reefs at depths as little as 1 m; adults rarely seen in less than 25 m, encountered off outer reef dropoffs in small schools. Feeds on large zooplankton during the day and shelter within the reef during the night.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plain brown or olivaceous in color, paler below; subadults with black caudal rays, narrow margins and white caudal filaments; pectoral fins with white distal margins (Ref. 3145).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Naso annulatus is found in shallow waters, with large adults typically found on steep drop-offs in more than 25 m, usually in small aggregations (Randall 2001a). It feeds on green filamentous algae as juveniles and gelatinous zooplankton as adults (Choat 1991, Choat and Clements 1998, Choat et al. 2002b). Ontogenetic change in diet tends to occur by at least 20 cm (SL) (Green and Bellwood 2009). Maximum age was 23 years in the Great Barrier Reef (Choat and Robertson 2002a).

The sexes are separate and there is evidence of sexual dimorphism in the caudal knives which are relatively larger in males. The males get the longer caudal filaments (J.H. Choat pers. comm. 2010).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 60 m (Ref. 27115), usually 25 - 60 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0.65 - 65
  Temperature range (°C): 25.807 - 28.465
  Nitrate (umol/L): 0.337 - 2.654
  Salinity (PPS): 34.449 - 35.095
  Oxygen (ml/l): 4.221 - 4.686
  Phosphate (umol/l): 0.121 - 0.349
  Silicate (umol/l): 0.869 - 6.450

Graphical representation

Depth range (m): 0.65 - 65

Temperature range (°C): 25.807 - 28.465

Nitrate (umol/L): 0.337 - 2.654

Salinity (PPS): 34.449 - 35.095

Oxygen (ml/l): 4.221 - 4.686

Phosphate (umol/l): 0.121 - 0.349

Silicate (umol/l): 0.869 - 6.450
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Juveniles occur in clear, shallow lagoon reefs at depths as little as 1 m; adults rarely seen in less than 25 m, encountered off outer reef drop-offs in small schools. Feed on large zooplankton during the day and shelter within the reef during the night; also feed on benthic algae (Ref. 30573, 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore, Omnivore

Diet: benthic microalgae, zooplankton, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawn in pairs (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Naso annulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCTTGAGCTGGAATAGTAGGCACAGCCTTAAGTCTACTTATTCGGGCAGAACTAAGCCAACCAGGCGCCCTCCTCGGAGATGACCAAATCTACAATGTAATTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGGTTTGGAAACTGACTAATTCCACTAATAATTGGGGCCCCAGATATGGCGTTCCCCCGAATAAATAACATGAGCTTTTGACTGCTCCCTCCCTCCTTCCTCCCCCTCCTTGCATCATCTGGTGTTGAAGCCGGGGCCGGAACCGGATGAACAGTCTACCCCCCTTTAGCCGGTAACCTAGCACATGCAGGAGCTTCCGTTGATCTAACTATTTTCTCCCTTCATCTGGCAGGAATCTCCTCAATTCTAGGGGCAATTAACTTTATCACCACCATTATTAATATGAAACCCCCCGCTATTTCTCAATACCAAACTCCCCTGTTCGTCCGAGCTGTACTAATCACGGCAGTAATACTGCTTCTTTCTCTTCCAGTTCTTGCTGCTGGTATTACAATGCTCCTTACCGACCGAAACCTTAATACAACCTTCTTCGACCCTGCAGGGGGAGGGGACCCCATCCTTTACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Naso annulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Naso annulatus is widespread in the Indo-Pacific region and is common in parts of its range. It is a targeted food fish in the Philippines and is harvested for food elsewhere in its range. There are no indications of population declines by harvesting. There are no major threats known and it is found in a number of marine protected areas in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the central Philippines, density and biomass of herbivorous fish in reserves had positive relationships with duration of reserve protection. Acanthuridae and Labridae (parrotfishes) were the major families that increased in biomass inside reserves with duration of reserve protection. Herbivore biomass inside reserves compared to fished sites was on average higher as years of protection increases. Naso annulatus mean biomass values (kg per 500 m2) recorded in 3 reserves were 0.67 (0.5 to 4 yr of protection), 0.10 (5 to 7 years of protection), 8.16 (8 to 11 years of protection), respectively (Stockwell et al. 2009).

This species is common in Tubbataha, Spratlys and northern Palawan (C. Nanola, S. Conales, Jr. and R. Abesamis pers. comm. 2010). It is uncommon in Guam and Saipan based on fish visual census (J. McIlwain unpub. data) and rare in the Guam and Saipan Acanthurid fishery (<1%) (Guam Division of Aquatic and Wildlife Resources unpub. data, P. Houk unpub. data). It was recorded as occasional in terms of relative abundance in the northern Bismarck Sea, Papua New Guinea (Allen 2009). It is moderately common, usually adjacent to steep outer slopes in Milne Bay Province, Papua New Guinea (Allen 2003). It is uncommon in the American Samoa National Park (National Park of Samoa Checklist of Fishes accessed 21 April 2010).

In Kenya, landings during 1978-2001 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s, but the landings for the scarinae showed a rising trend in recent years (Kaunda-Arara et al. 2003).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Whitemargin unicornfish

The whitemargin unicornfish (Naso annulatus) is a tropical fish found throughout the Indo-Pacific. It can reach a length of 100 cm, making it one of the largest members of the family Acanthuridae.


Description[edit]

It is brown in color and has a large, distinguishing "nasal" protrusion. The tail is black surrounded by a white margin. It is often found in large schools off tropical reefs, and it feeds on zooplankton. The fish has two scutes on the left side. These are found on the caudal peduncle near the tail.

Whitemargin unicornfish

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!