Overview

Comprehensive Description

Biology

Inhabits northern, and mountain and foothill streams, and oligotrophic lakes. Found in fast-flowing waters of coastal streams, rivers, inland lakes, usually on stony bottoms (Ref. 4698). Moves downstream to estuaries and tolerates brackish waters (Ref. 4698). Feeds on algae (diatoms, desmids, blue-green algae), polychaetes, crustaceans, aquatic insect larvae and nymphs (Ephemeroptera, Trichoptera, Plecoptera, Chironomidae), fish eggs and larvae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Streams in Carpathians draining to Danube, Dniestr, Vistula and Odra. Baltic basin, especially in northern Sweden and Finland between 64 and 68°N, central Finnish lakes area, a few streams in southern Finland, Lake Ladoga and southern Lake Onega drainage, a few lakes in northern Germany (extirpated), Lake Hancza (Poland) and Skjernaa drainage (Denmark). In Siberia from River Ob eastward to Lena. Absent in rivers draining to Baltic Sea south of Iijöki drainage in central Finland and in rivers draining to the White and Barents Seas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Europe: Streams in Carpathians draining to Danube, Dniestr, Vistula and Odra. Baltic Sea basin, especially in northern Sweden and Finland between 64 and 68°N, central Finnish lakes area, a few streams in southern Finland and northern Poland, Lake Ladoga and southern Lake Onega basins, a few lakes in northern Germany (extirpated), Lake Hañcza in Poland and Skjernaa drainage in Denmark. In Siberia from River Ob eastward to River Lena. Absent in rivers draining to Baltic Sea south of Iijöki drainage in central Finland and in rivers draining to the White and Barents Seas. Cottus populations from the Kolyma, Amur and Korean drainages usually identified as Cottus poecilopus belong to a different species. In Appendix III of the Bern Convention (protected fauna).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cental Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lena River and its tributaries, Russia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 4698)); max. reported age: 8 years (Ref. 4698)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from all other species of Cottus in Europe by possessing spatulate prickles; pelvic-fin rays tessellated, with 5-15 distinct rows of spot, appearing as transverse bands; and 2 chin pores. Additional characters useful in the identification of this species include: lateral line clearly above midline of body (shared only with C. koshewnikowi); lateral line clearly above midline of body; lateral line incomplete, usually reaching to anal-fin base; and prickling restricted to body under pectoral fin (Ref. 55856).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Northern, and mountain and foothill streams, oligotrophic lakes. In Carpathian streams usually more upstream than C. gobio, very rarely syntopic.

Biology:
Lives up to six years. Spawns for the first time at 2-4 years, about 40 mm SL. Spawns in February-April, when temperature rises above 5°C. Females spawn once a year. Most individuals spawn 2-3 seasons. They lay adhesive eggs in a compact clutch on ceiling of small cavities in gravel or rock bottom. Males guard eggs until hatching. Males may guard egg clutches of several females. Nocturnal, shifts to day-activity during winter in the Arctic. Feeds on a wide variety of benthic invertebrates.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; brackish; depth range 0 - 15 m (Ref. 58496)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 20 - 20
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in fast-flowing waters of coastal streams, rivers, inland lakes, usually on stony bottoms. Moves downstream to estuaries and tolerates brackish waters. Feeds on algae (diatoms, desmids, blue-green algae), polychaetes, crustaceans, aquatic insect larvae and nymphs (Ephemeroptera, Trichoptera, Plecoptera, Chironomidae), fish eggs and larvae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females spawn onces a season. Most individuals spawn 2-3 seasons. They lay adhesive eggs in a compact clutch on ceiling of small cavities in gravel or rock bottom. Males guard eggs until hatching. males may guard egg clutches of several females. (Ref.59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cottus poecilopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCCATCACACGATGATTCTTCTCGACTAATCACAAAGACATTGGCACCCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTCCTAATTCGAGCAGAACTAAGCCAACCCGGTGCCCTCTTGGGGGACGACCAGATTTATAATGTAATTGTTACGGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATCGGAGGCTTCGGGAACTGACTCATTCCCCTAATGATTGGCGCCCCTGATATGGCCTTTCCTCGAATAAACAACATGAGCTTCTGACTTCTCCCCCCATCTTTTCTCCTCCTCCTTGCCTCTTCGGGGGTCGAAGCAGGGGCCGGAACCGGGTGAACAGTCTACCCGCCCCTCGCCGGAAACCTCGCCCACGCAGGTGCCTCTGTAGACCTAACGATCTTCTCCCTCCACCTAGCAGGAATCTCCTCTATTCTAGGAGCAATTAACTTTATCACAACCATCATTAACATGAAACCTCCTGCTATCTCACAGTACCAGACCCCTCTCTTCGTGTGATCTGTTCTTATTACTGCTGTCTTACTGCTTCTTTCTCTCCCTGTTCTTGCTGCCGGCATTACCATGCTCTTAACAGACCGAAACCTTAACACCACCTTCTTTGACCCCGCAGGGGGAGGGGACCCAATCCTTTACCAACATCTCTTTTGATTCTTTGGTCACCCTGAAGTCTACATTCTTATTCTACCGGGGTTCGGCATGGTATCTCACATTGTTGCCTACTACTCAGGCAAAAAAGAACCTTTTGGATACATGGGCATGGTGTGAGCCATGATGGCTATTGGCCTTCTAGGGTTCATCGTGTGAGCCCATCACATGTTCACAGTCGGAATAGACGTAGACACCCGAGCTTACTTTACATCCGCCACAATAATTATTGCCATCCCAACGGGCGTTAAAGTTTTCAGCTGGCTTGCCACCCTCCACGGCGGCTCCATCAAATGAGAGACCCCTCTTTTATGAGCTCTCGGCTTCATCTTCCTCTTTACAGTAGGAGGCTTAACGGGCATTGTCCTTGCCAACTCCTCCCTAGACATCGTCCTACACGACACGTACTACGTAGTTGCACATTTCCATTACGTCCTATCTATGGGTGCCGTCTTTGCTATCGTTGCAGGCTTCGTCCACTGGTTCCCCCTTTTCTCAGGATACACACTTCACAGCACCTGAACAAAAATCCACTTCGGGGTAATATTTCTTGGAGTTAACCTCACCTTCTTCCCCCAACACTTCCTGGGCTTAGCCGGAATGCCTCGGCGATACTCAGACTACCCAGATGCCTACACCCTGTGAAACACTGTCTCTTCAATCGGATCTCTGATTTCCCTGGTAGCAGTAATTATGTTTCTCTTTATCATCTGAGAAGCTTTCGCTGCCAAACGTGAAGTCCTAGCCGTAGAACTTACAATAACCAATGTAGAATGACTACACGGCTGCCCTCCCCCATACCACACATTCGAGGAGCCTGCATTTGTTCTAGTTCAATCAAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cottus poecilopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species with no known major widespread threats, however the species is extirpated in Germany.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alpine bullhead

The Alpine bullhead[2] or Siberian bullhead (Cottus poecilopus) is a species of freshwater fish in the Cottidae family of sculpins. It is found in Belarus, China, the Czech Republic, Denmark, Estonia, Finland, Germany, North Korea, Latvia, Lithuania, Moldova, Norway, Poland, Romania, Russia, Slovakia, Slovenia, Sweden, and Ukraine. This fish is listed as being of "Least Concern" by the IUCN.[1]

Description[edit]

The Alpine bullhead has a large broad head and tapering body, large fins and a rounded tail. The eyes are located near the top of the head. This fish resembles the European bullhead and the freshwater form of the fourhorn sculpin. It can be told from the former by the fact that the innermost ray of its pelvic fins is shorter than the outermost ray rather than being of similar length. It can be distinguished from the fourhorn sculpin by the fact that the dorsal and anal fins terminate close to the tail giving a short caudal peduncle. When it rests on the bottom, the pectoral fins flare out resembling wings. The Arctic bullhead is usually about 5 to 8 cm (2.0 to 3.1 in) long with a maximum of 12 cm (5 in). It is light brown mottled with darker colour. The pelvic fins are spotted with darker colour and appear banded when bunched as against the European bullhead's clear fins.[3]

Distribution and habitat[edit]

The Alpine bullhead is found in northern and central Europe in upland and coldwater streams and lakes in mountain regions.[1]

Biology[edit]

The Alpine bullhead feeds on insects, crustaceans and small invertebrate prey that it finds on the bed of the stream. It is generally nocturnal but becomes diurnal in the Arctic during the winter. In spring, when the water temperature rises to 5 °C (41 °F), a male will prepare a nest site under a large stone and several females will lay their eggs in it. The male then guards the nest for the month or so until the eggs hatch.[1][3]

References[edit]

  1. ^ a b c d Freyhof, J.; Kottelat, M. (2008). "Cottus poecilopus". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-12-17. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Cottus poecilopus" in FishBase. April 2006 version.
  3. ^ a b "Alpine bullhead: Cottus poecilopus". NatureGate. Retrieved 2013-12-17. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!