Overview

Brief Summary

Biology

The diet of the oceanic whitetip shark primarily consists of bony fishes such as tuna and mackerel, but also includes stingrays, sea turtles, sea birds, squid, crustaceans, mammalian carrion (dead whales and dolphins), and occasionally even rubbish that is disposed in the sea (3). The species is usually solitary, but will occasionally congregate in groups during 'feeding frenzies' where food is plentiful (4), such as around whale carcasses (7). However, if other shark species are encountered competing for the same food source, the oceanic whitetip shark usually dominates over them, and may become aggressive (3) (4). This shark is often accompanied by remoras, dolphin fishes and pilot fishes, and reportedly demonstrates an unusual association with the shortfin pilot whale (Globicephala macrorhynchus) in Hawaiian waters (2) (3). Although the exact reason for this shark swimming along with pods of pilot whales is unknown, it is suspected that oceanic whitetip sharks are following them to sources of squid, which the pilot whales are extremely efficient at locating (3). This species mates during the early summer in the north-western Atlantic and the south-western Indian Ocean, and females give birth to 1 to 15 live young approximately a year later (3) (6). Reproduction is viviparous, with live young being born after being nourished by a placental yolk-sac that is attached to the uterine wall by umbilical cords (3). Sexual maturity is attained at an age of six to seven years for both sexes (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Considered one of the five most dangerous sharks in the world, the oceanic whitetip shark has a stocky build, a short, bluntly-rounded snout, and incredibly powerful jaws (3) (4). This voracious predator grips its prey with the pointed teeth of the lower jaw, serrated only at the tip, while the broader, triangular, serrated teeth in the upper jaw are used to saw, cut and tear the flesh (3) (4). The first dorsal fin is distinctively large and rounded, and the paddle-like pectoral fins are very long and wide (3). The oceanic whitetip shark is so named because the tips of its pectoral, first dorsal, pelvic, and caudal fins are often white or show white mottling (2) (3) (4). These markings are usually black on young individuals below 1.3 meters, and a dark, saddle-shaped marking may also be present between the first and second dorsal fin (3) (5). Depending upon geographic location, the body colour may be brown, grey, beige or bronze, sometimes bluish, while the stomach is usually white, occasionally with a yellow tinge (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

An oceanic deep-water species which sometimes comes close to shore (Ref. 244). Found surface to depths of at least 150 m (Ref. 26938). Epipelagic usually over water depths of >184 meters (Ref. 58302). Frequently accompanied by Remora, Coryphaena, pilot fishes (Ref. 30573), and tortoises. Feeds oceanic bony fishes, also threadfins, stingrays, sea turtles, sea birds, gastropods, squid, crustaceans, mammalian carrion and garbage (Ref. 5578), including tuna and mahimahi (Ref. 1602, 37816). Viviparous (Ref. 50449). There is pronounced partial segregation by size and sex in some areas. This is an active, almost fearless shark also charged in human attacks (Ref. 244). Probably responsible for many open-ocean attacks after air or sea disasters (Ref. 6871). Utilized fresh, frozen (Ref. 9987), smoked, and dried-salted for human consumption; hides for leather, fins for fin soup, liver oil for vitamins, also processed into fishmeal (Ref. 244). 1 to 15 young, 60 to 65 cm, are born per litter (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol)
 
Carcharhinus longimanus (Poey, 1861)


Oceanic whitetip shark


Moderately stout; snout moderately short and broadly rounded, length 1-1.1 in distance between nostrils; nasal flaps very small, rudimentary; upper front teeth broadly triangular, straight, serrated; lower front teeth with narrow, high, straight points; ridge on back between dorsal fins usually present; origin of first dorsal fin slightly before inner rear corner of pectoral fins; first dorsal fin very large, with broadly rounded tip, its height 9.2-15.2% of TL; pectoral fins extremely long (length of front edge 20.2- 27.1% of TL),  with broad round tips; origin of second dorsal in front of or over anal fin origin.

Brownish grey on back, becoming white ventrally; tips of first dorsal fin, paired fins, and caudal fin lobes broadly mottled white; anal fin usually blackish at tip and second dorsal fin may be dusky at tip;  juveniles with most fins tipped with black.


Grows to 396 cm; 60-65 cm at birth.

Habitat: oceanic epipelagic.

Depth: 0-200 m.

Circumtropical; central Baja to the lower Gulf of California to Peru and the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Azores Exclusive Economic Zone, Chagos, Comores, Djibouti, Eritrea, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan (Ref. 26340). Western Atlantic: Maine, USA to Argentina; also in Gulf of Mexico and Caribbean (Ref. 26938). Eastern Atlantic: Portugal to Gulf of Guinea; possibly occurring in the Mediterranean. Indo-Pacific: Red Sea and East Africa to the Hawaiian, Samoan, Tahiti and Tuamoto islands. Eastern Pacific: southern California, USA to Peru, including the Galapagos. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This is one of the most widespread of shark species, ranging across entire oceans in tropical and subtropical waters, usually found far offshore between about 30°N and 35°S in all oceans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine (near NE edge Georges Bank - Scott & Scott, 1988) to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and subtropical seas (including Red Sea, Comores, Mascarenes, Hawaiian Islands), straying into temperate waters including North Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 200 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This widely distributed species can be found from Maine, U.S., south to Argentina in the Western Atlantic Ocean, including the Caribbean and Gulf of Mexico, and from Portugal to the Gulf of Guinea, in the Eastern Atlantic, possible including the Mediterranean. In the Indo-Pacific, this shark inhabits waters from the Red Sea and East Africa to Hawaii, Samoa, Tahiti and the Tuamoto Islands. In the Eastern pacific the distribution includes waters from southern California, U.S., south to Peru, including the Galapagos (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 396.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3960 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

396 cm TL (male/unsexed; (Ref. 2334)); max. published weight: 167.4 kg (Ref. 40637); max. reported age: 22 years (Ref. 31395)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A stocky shark with a huge, rounded 1st dorsal fin, and long, wide-tipped pectoral fins; snout bluntly rounded; upper teeth triangular; interdorsal ridge present (Ref. 5578). Back usually dark grey with a bronze tinge, sometimes brown or bluish; belly whitish, sometimes with a yellow tinge; tips off first dorsal, pectorals, and lower lobe of caudal often white or with white spots (sometimes absent); ventral surface of pelvic fins, apices of anal and second dorsal, and ventral lobe of caudal often with black spots; black or dusky saddle-marks in front of second dorsal, upper margin of caudal and between dorsal fins (especially in young) (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Oceanic (Ref. 9987). A deep water species which seldom comes close to shore. Preferred water temperatures range from 18 to 28°C. Frequently accompanied by @Remora@ and @Coryphaena@, and tortoises. Feeds mainly on pelagic fish and cephalopods. There is pronounced partial segregation by size and sex in some areas.This is an active, almost fearless shark also charged in human attacks. Utilized for human consumption, for leather, for finsoup, and for oil. Marketed fresh, dried-salted and frozen (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Carcharhinus longimanus
Catalog Number: USNM 50859
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Diamond Head, Oahu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Type: Snyder, J. O. 1904. Bulletin of the United States Fish Commission. 22 (for 1902): 513, fig. 1; pl. 1.; Howe, J. C. & Springer, V. G. 1993. Smithsonian Contributions to Zoology. No. 540: 8.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 230 m (Ref. 58302), usually 0 - 152 m (Ref. 55185)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is one of the most widespread sharks, ranging across entire oceans in tropical and subtropical waters. The oceanic whitetip is an oceanic-epipelagic shark, usually found far offshore in the open sea in waters >200 m deep, between about 30°N and 35°S in all oceans; it is normally found in surface waters, although it has been recorded to 152 m. It has occasionally been recorded inshore, but is more typically found offshore or around oceanic islands and areas with narrow continental shelves (Fourmanoir 1961, Compagno in prep, Last and Stevens 1994). Temperatures of waters in which it regularly occurs are 18 to 28°C, with water above 20°C preferred. Although one whitetip was caught in water of 15°C it tends to withdraw from waters that are cooling below this, as in the Gulf of Mexico in winter (Compagno in prep.).

This is a slow-moving but quite active shark, apparently equally active at daytime or night (Compagno in prep., Ebert 2003).

Development is viviparous and embryos have a yolk sac placenta that attaches to the uterine wall of the mother (Bigelow and Schroeder 1948). Born at about 60 to 65 cm TL after a gestation period of about 10 to 12 months (Compagno in prep.), males mature at about 170 to 96 cm and females at 170 to 190 cm TL (Seki et al. 1998). Oceanic whitetip sharks grow to a large size, with some individual reaching almost 4 m. However, most known specimens are <3 m in length. Litter sizes vary from about 1 to 14 (Bass et al. 1973, Stevens 1984, Seki et al. 1998), although 15 foetuses were recorded from a female of 245 cm TL from the Red Sea (Gohar and Mazure 1964) and larger females appear to carry more young, although there may be regional variation (Bass et al. 1973). Birth is thought to occur in early summer in the northwest Atlantic and south west Indian Oceans (Bass et al. 1973), and January to March off New South Wales (Stevens 1984), whereas Seki et al. (1998) found that parturition was February to July in the North Pacific. Pregnant females of this species are less frequently found in the Indian Ocean than other sharks of this genus (Gubanov 1978). In the Central Pacific, females with small embryos have been found throughout the year, suggesting a less tight seasonality of birth (and presumably mating) than the Western Atlantic (Compagno in prep). Also, non-breeding adult females have been found to outnumber gravid females in the equatorial Central Pacific (Compagno in prep). The location of nurseries has not been reported, but very young oceanic whitetip sharks have been found well offshore along the southeastern US, suggesting offshore nurseries over the continental shelves (Compagno in prep).

Seki et al. (1998) studied the age, growth and reproduction of the oceanic whitetip in the north Pacific. They found similar growth rates in both males and females with a Von Bertalanffy equation of: Lt = 299.58 * {1 - e-0.103 x (t + 2.698)} where Lt is expressed as precaudal length in cm at age t. They used Bass et al.?s (1973) transformation of TL = 1.397 x PL for conversions to total length. Using vertebral analysis they showed that annular formation occurred in spring. Both male and female oceanic whitetips matured at 4 to 5 years of age. Smith et al. (1998) investigated the intrinsic rebound potential of Pacific sharks and found that oceanic whitetips to be among a moderate rebound potential, because of their relatively fast growth and early maturation.

This pelagic species feeds mainly on bony fishes (including tunas, barracuda, white marlin, dolphinfish, lancetfish, oarfish, threadfish, swordfish) and cephalopods and to a lesser extent, seabirds, marine mammals, stingrays, and flotsam, including garbage.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mainly oceanic, found along the coast in tropical and warm temperate waters.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 329 specimens in 1 taxon.
Water temperature and chemistry ranges based on 292 samples.

Environmental ranges
  Depth range (m): 48 - 4655
  Temperature range (°C): 1.478 - 27.155
  Nitrate (umol/L): 0.553 - 39.498
  Salinity (PPS): 34.796 - 36.454
  Oxygen (ml/l): 1.033 - 6.302
  Phosphate (umol/l): 0.110 - 2.960
  Silicate (umol/l): 0.774 - 97.395

Graphical representation

Depth range (m): 48 - 4655

Temperature range (°C): 1.478 - 27.155

Nitrate (umol/L): 0.553 - 39.498

Salinity (PPS): 34.796 - 36.454

Oxygen (ml/l): 1.033 - 6.302

Phosphate (umol/l): 0.110 - 2.960

Silicate (umol/l): 0.774 - 97.395
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 152m.
Recorded at 152 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This shark is an oceanic, epipelagic species found mainly in offshore, tropical and warm-temperate waters (6), although on occasion in shallower waters near land, usually near oceanic islands (3). Found from the surface to depths of at least 150 m (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes, sea snakes/mammals/turtles/birds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449). Litter size 1-15 pups; 60-65 cm at birth (Ref. 244). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 22 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus longimanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGAGATGATCAGATTTATAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTCATGGTTATACCAATTATAATTGGTGGTTTCGGAAATTGATTAGTCCCTTTAATAATTGGAGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCGTCATTTCTTCTCCTTCTCGCCTCTGCTGGAGTAGAGGCTGGAGCAGGTACTGGTTGAACAGTTTATCCTCCATTAGCTAGCAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATCACAACCATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGGATTACAATATTACTTACAGACCGTAACCTTAATACTACATTCTTTGATCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus longimanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ad+3d+4ad

Version
3.1

Year Assessed
2006

Assessor/s
Baum, J., Medina, E., Musick, J.A. & Smale, M.

Reviewer/s
Cavanagh, R.D., Stevens, J., Dudley, S., Pollard, D. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
Global:
This formerly widespread and abundant large oceanic shark is subject to fishing pressure virtually throughout its range. It is caught in large numbers as a bycatch in pelagic fisheries, with pelagic longlines, probably pelagic gillnets, handlines and occasionally pelagic and even bottom trawls. Catches, particularly in international waters, are inadequately monitored. Its large fins are highly prized in international trade although the carcass is often discarded. Fishery pressure is likely to persist if not increase in future. Outside of the areas detailed below, this species is under similar fishing pressure from multiple pelagic fisheries, there are no data to suggest that declines would and have not have also occurred in these areas, given there are similar fisheries throughout the range. As such, a precautionary global assessment of Vulnerable is considered appropriate for the oceanic whitetip. Efforts are underway to improve the collection of data from some regions and effective conservation and management of this species will require international agreements.

Northwest Atlantic and Western Central Atlantic:
The oceanic whitetip shark is assessed as Critically Endangered in the Northwest and Western Central Atlantic because of the enormous declines that have been reported. Two estimates of trends in abundance from standardized catch rate indices were made from independent datasets. An analysis of the US pelagic longline logbook data between 1992 and 2000, which covers the Northwest and Western Central Atlantic regions, estimated declines of 70%. An analysis of the Gulf of Mexico, which used data from US pelagic longline surveys in the mid-1950s and US pelagic longline observer data in the late-1990s, estimated a decline of 99.3% over this forty year time period or 98% over three generations (30 years). However, changes in fishing gear and practices over this time period were not fully taken into account in the latter analysis, and there is currently debate as to whether or not these changes may have resulted in an under- or overestimation of the magnitude of these declines.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species, together with the silky shark Carcharhinus falciformis and blue shark Prionace glauca, has often been described as one of the three most abundant species of oceanic sharks and large marine animals (Compagno 1984, Taniuchi 1990, Bonfil 1994, Castro et al. 1999). Recent observations, however, indicate that this species that was formerly ?nearly ubiquitous in water deeper than 180 m and above 20°C? (Castro et al. 1999) is now only occasionally recorded (e.g., Baum and Myers 2004, Domingo 2004).

The population dynamics and structure of this species are unknown. Distribution appears to depend on size and sex and the nursery areas appear to be oceanic (Seki et al. 1998). Larger individuals are caught deeper than smaller ones and there is geographic and sexual segregation (Anderson and Ahmed 1993). Longline catches in the Central Pacific show that this species definitely increases in abundance as a function of increasing distance from land, and, unlike the silky shark Carcharhinus falcifomis, it does not congregate around land masses (Compagno in prep.).

In the Northwest and Western Central Atlantic enormous declines are estimated to have occurred. Two estimates of trends in abundance from standardized catch rate indices have been made from independent datasets. An analysis of the US pelagic longline logbook data between 1992 and 2000, which covers the Northwest and Western Central Atlantic regions, estimated declines of 70% (Baum et al. 2003). An analysis of the Gulf of Mexico, which used data from US pelagic longline surveys in the mid-1950s and US pelagic longline observer data in the late-1990s, estimated a decline of 99.3% over this forty year time period (Baum and Myers 2004). When trends in abundance from the former analysis are extrapolated back to the mid-1950s, they match the latter analysis almost exactly (99.8%). Over a period of three generations (30 years), the estimated decline is 98%. However, the latter study has recently been criticized because temporal changes in fishing gear and practices over the time period were not taken fully into account and the study may, therefore, have exaggerated or underestimated the magnitude of the declines (Burgess et al. 2005, Baum et al. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2ad+3d+4ad)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Oceanic whitetip sharks have been caught in large numbers virtually everywhere they occur, particularly in pelagic longline and drift net fisheries. This species was initially described as the most common pelagic shark beyond the continental shelf in the Gulf of Mexico (Wathne 1959, Bullis 1961), and throughout the warm-temperate and tropical waters of the Atlantic and Pacific (Mather and Day 1954, Strasburg 1957). In the Gulf of Mexico, for example, between 2 and 25 of these sharks were usually observed following the vessel during longline retrieval on the exploratory surveys in the 1950s and their abundance was considered as a serious problem because of the high proportion of tunas they damaged (Bullis and Captiva 1955, Backus et al. 1956, Wathne 1959). Recent shark papers on the Gulf of Mexico have either not mentioned this species or have dismissed it as rare, not recognising its former prevalence in the area (Baum and Myers 2004).

Few data are available on the catch rate of these sharks, and this is a serious hindrance to assessing the status of this species in regions other than the Northwest Atlantic and Eastern Central Pacific. Strasburg (1958) reported that the oceanic whitetip shark constituted 28% of the total shark catch in exploratory tuna longline fishing south of 100 N latitude in the central Pacific Ocean. According to Berkeley and Campos (1988), oceanic whitetip sharks constituted 2.1% of the shark bycatch in the swordfish fishery along the east coast of Florida in 1981 to 1983. Taniuchi (1990) analysed Japanese fishery statistics and noted that this species was most commonly taken by fishery boats in the Pacific, where they made up 20 to 30% of the number of sharks taken by tuna longliners, compared to about 3 to 4% in the Indian Ocean, because the boats are fishing for southern bluefin tuna in cooler waters. Guitart Manday (1975) demonstrated a marked decline in the oceanic whitetip shark landings in Cuba from 1971 to 1973. In the Maldives, Anderson and Ahmed (1993) reported that oceanic whitetip sharks were taken commercially by pelagic shark longliners and incidentally by tuna fishermen, and that in a previous exploratory fishing survey oceanic whitetip sharks constituted 23% of all sharks caught.

Domingo (2004) reported that the Uruguayan longline fleet observer programme in 1998 to 2003 recorded catch rates of only 0.006 sharks/1,000 hooks in Uruguayan and adjacent high seas South Atlantic waters (latitude 26° to 37°, 16 to 23°C) and 0.09 sharks/1,000 hooks in international waters off the Atlantic coast of Africa. He notes that similarly infrequent records are obtained by Brazilian and Ecuadorian Atlantic longline fleets.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The oceanic whitetip shark suffers from fishing pressure throughout most of its range, with large numbers being caught as bycatch by tuna and other pelagic fisheries (1) (3). The shark's large fins are highly prized in international trade, being sold to the Far East to make shark-fin soup, but the remainder of the carcass is often discarded (1). Although classified as Vulnerable overall, this species has been assessed as Critically Endangered by the IUCN in the Northwest and Western Central Atlantic, due to massive declines in reported catch quantities indicating significant population declines (1). However, catches in international waters elsewhere are often inadequately monitored, and there is simply insufficient data to asses the real impact fisheries are having (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation and management action are urgently required for this species; the only known conservation measure at present is a broad, multi-species pelagic shark quota for U.S. Atlantic waters. Specifically, fishing pressure on this species must be considerably decreased through reduction in fishing effort, catch limits, measures to enhance chances of survival after capture and possibly also through the implementation of large-scale oceanic non-fishing areas. Effective conservation of this species will require international cooperation. The oceanic whitetip is listed as a highly migratory species under the 1995 UN Agreement on the Conservation and Management of Straddling Fish Stocks and Highly Migratory Fish Stocks (UNFSA). The Agreement specifically requires coastal States and fishing States to cooperate and adopt measures to ensure the conservation of these listed species. To date, there is little progress in this regard. See United Nations Convention on the Law of the Sea for further details. Also of relevance is the FAO International Plan of Action for the Conservation and Management of Sharks (IPOA-Sharks) which specifically recommends that Regional Fisheries Organisations (RFO) carry out regular shark population assessments and that member States cooperate on joint and regional shark management plans. This is of particular importance for pelagic sharks such as C. longimanus whose stocks are exploited by more than one State on the high seas. Although steps are being taken by some RFOs to collect species-specific data on pelagic sharks, and to ban the practise of shark finning, to date no RFO has limited shark catches or drafted a ?Shark Plan? as suggested in the IPOA-Shark guidelines (R. Cavanagh, pers. comm).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Efforts are currently being made to collect essential data on population declines from regions where demographic trends are poorly understood. While the information gained will certainly help guide future conservation measures, truly effective conservation and management will depend upon international cooperation, and acceptance of a collective responsibility to help protect this magnificent oceanic shark (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Oceanic whitetip shark

The oceanic whitetip shark (Carcharhinus longimanus) is a large pelagic shark inhabiting tropical and warm temperate seas. Its stocky body is most notable for its long, white-tipped, rounded fins.

This aggressive but slow-moving fish dominates feeding frenzies, and is a danger to shipwreck or air crash survivors.[3] Recent studies show steeply declining populations because its large fins are highly valued as the chief ingredient of shark fin soup and, as with other shark species, the whitetip faces mounting fishing pressure throughout its range.[1][4]

Contents

Taxonomy [edit]

The oceanic whitetip shark, or lesser white shark was first described by naturalist René-Primevère Lesson in his account of Louis Duperrey's 1822–1825 world-circling journey on the corvette Coquille. Lesson described two specimens found in the Tuamotu Archipelago in French Polynesia, and named the shark Squalus maou after a Polynesian word for "shark". However, Lesson's description and name were forgotten.[5][not in citation given]

It was next described by Cuban Felipe Poey in 1861 as Squalus longimanus.[5] The name Pterolamiops longimanus has also been used. The species epithet longimanus refers to the size of its pectoral fins (longimanus translates from Latin as "long hands").[6] The oceanic whitetip shark has many common names in English: Brown Milbert's sand bar shark, brown shark, nigano shark, whitetip whaler, and whitetip shark.[6]

The rules of the International Commission on Zoological Nomenclature are that in general the first-published description has priority; therefore the valid scientific name for the oceanic whitetip shark should be Carcharhinus maou. However, Lesson's name remained forgotten for so long that Carcharhinus longimanus, which means long-hands, remains widely accepted.[7]

Distribution and habitat [edit]

The oceanic whitetip is found globally in deep, open water, with a temperature greater than 18 °C (64 °F).[2] It prefers waters between 20 °C (68 °F) and 28 °C (82 °F) and tends to withdraw from areas when temperatures fall outside of this.[7] They were once extremely common and widely distributed, and still inhabit a wide band around the globe; however, recent studies suggest that their numbers have drastically declined.[4] An analysis of the US pelagic longline logbook data between 1992–2000 (covering the Northwest and Western Central Atlantic) estimated a decline of 70% over that period.[1]

They are found worldwide between 45° north and 43° south latitude.[5][2] In 2004, an oceanic whitetip was discovered dead on the west coast of Sweden—far beyond what was once considered the northern boundary of its range.[8]

The shark spends most of its time in the upper layer of the ocean—to a depth of 150 metres (490 ft)[2]—and prefers off-shore, deep-ocean areas. According to longline capture data, increasing distance from land correlates to a greater population of sharks.[6] Occasionally it is found close to land, in waters as shallow as 37 metres (120 ft), mainly around mid-ocean islands such as Hawaii, or in areas where the continental shelf is narrow and there is access to nearby deep water. It is typically solitary, though gatherings have been observed where food is plentiful.[7] Unlike many animals, it does not have a diurnal cycle, and is active both day and night.[6] Its swimming style is slow, with widely spread pectoral fins. Despite their habitual isolation from members of their own species, pilot fish, dolphinfish, and remora may accompany them.[6] In 1988, Jeremy Stafford-Deitsch reported seeing an individual accompanied by a shortfin pilot whale.[9]

Anatomy and appearance [edit]

Drawing of shark with prominent, all white-tipped fins
Sketch of an oceanic whitetip shark

C. longimanus' most distinguishing characteristics are its long, wing-like pectoral and dorsal fins. The fins are significantly larger than most other shark species, and are conspicuously rounded. The shark's nose is rounded and its eyes are circular, with nictitating membranes.[6]

C. longimanus has a 'typical', although somewhat flattened requiem shark body, often with a mildly humpbacked aspect. It is bronze, brown, bluish or grey dorsally (the colour varies by region), and white ventrally (although it may occasionally have a yellow tint). The oceanic whitetip shark is a medium-sized requiem shark. The largest specimen ever caught measured 4 m (13 ft), an exceptionally large size considering few specimens are known to exceed a length of 3 m (9.8 ft). The maximum reported weight is 170 kg (370 lb). The female is typically larger than the male by 10 cm (3.9 in). Males attain sexual maturity at 1.7 to 1.9 m (5.6 to 6.2 ft) and females about 1.8 to 2 m (5.9 to 6.6 ft).[6][7] In the Gulf of Mexico in the 1950s, the mean weight of oceanic whitetip sharks was 86.4 kg (190 lb). In the 1990s, the sharks of the species from the same area averaged only 56.1 kg (124 lb).[10]

Most of its fins (dorsal, pectoral, pelvic, and caudal) have white tips (juvenile specimens and some adults may lack these). Along with white tips, the fins may be mottled, and in young specimens can have black marks. A saddle-like marking may be apparent between first and second dorsal fins.[6] The shark has several kinds of teeth. Those in the mandible (lower jaw) have a thin serrated tip and are relatively small and triangular (somewhat fang-like). There are between 13 and 15 teeth on either side of the symphysis. The teeth in the upper jaw are triangular, but much larger and broader with entirely serrated edges—there are 14 or 15 along each side of the symphysis.[6] The denticles lie flat and typically have between five and seven ridges.[6]

Diet [edit]

C. longimanus feeds mainly on pelagic cephalopods and bony fish.[2] However, its diet can be far more varied and less selective—it is known to eat threadfins, stingrays, sea turtles, birds, gastropods, crustaceans, and mammalian carrion. The bony fish it feeds on include lancetfish, oarfish, barracuda, jacks, dolphinfish, marlin, tuna, and mackerel. Its feeding methods include biting into groups of fish and swimming through schools of tuna with an open mouth. When feeding with other species, it becomes aggressive.[7] Peter Benchley, author of Jaws, observed this shark swimming among pilot whales and eating their faeces.[11]

Behaviour [edit]

Shark accompanied by group of fish with black and white vertical stripes and split tail fin
Oceanic whitetip photographed at the Elphinstone reef, Red Sea, Egypt, accompanied by pilot fish

The oceanic whitetip is usually solitary and slow-moving, and tends to cruise near the top of the water column, covering vast stretches of empty water scanning for possible food sources.[6] Until the 16th century,[12] sharks were known to mariners as "sea dogs"[13] and the oceanic whitetip, the most common ship-following shark,[7] exhibits dog-like behaviour when its interest is piqued: when attracted to something that appears to be food, its movements become more avid and it will approach cautiously but stubbornly, retreating and maintaining a safe distance if driven off, but ready to rush in if the opportunity presents itself. Oceanic whitetips are not fast swimmers, but they are capable of surprising bursts of speed. Whitetips commonly compete for food with silky sharks, making up for its comparatively leisurely swimming style with aggressive displays.[7]

Groups often form when individuals converge on a food source, whereupon a feeding frenzy may occur. This seems to be triggered not by blood in the water or by bloodlust, but by the species' highly strung and goal-directed nature (conserving energy between infrequent feeding opportunities when it is not slowly plying the open ocean). The oceanic whitetip is a competitive, opportunistic predator that exploits the resource at hand, rather than avoiding trouble in favour of a possibly easier future meal.[7]

There does not seem to be segregation by sex and size. Whitetips follow schools of tuna or squid, and trail groups of cetaceans such as dolphins and pilot whales, scavenging their prey. Their instinct is to follow baitfish migrations that accompany ocean-going ships. When whaling took place in warm waters, oceanic whitetips were often responsible for much of the damage to floating carcasses.[7]

Reproduction [edit]

Mating season is in early summer in the northwest Atlantic Ocean and southwest Indian Ocean, although females captured in the Pacific have been found with embryos year round, suggesting a longer mating season there.[7] The shark is viviparous—embryos develop in utero and are fed by a placental sac. Its gestation period is one year. Litter sizes vary from one to 15 with the young born at a length of about 0.6 metres (24 in).[1] Sexual maturity is reached at close to 1.75 metres (69 in) for males and 2 metres (80 in) for females.[1]

Relation to humans [edit]

Photo of shark with black and white-striped fish
Oceanic whitetip shark with a small school of pilot fish

It is a commercially important species for its fins, its meat and oil. It is eaten fresh, smoked, dried and salted and its hide is used for leather.[7] It is subject to fishing pressure throughout virtually its whole range[1]—although it is more often taken as by-catch than by design, since it is drawn to longline bait that is intended for other species.[7]

Famed oceanographic researcher Jacques Cousteau described the oceanic whitetip as "the most dangerous of all sharks".[14] Despite the greater notoriety of the great white shark and other sharks habitually found nearer the shore, the oceanic whitetip is suspected to be responsible for many fatal attacks on humans, as a result of predation on survivors of shipwrecks or downed aircraft.[3][15] Such incidents are not included in common shark-attack indices for the 20th and 21st centuries, and as a result of this, the oceanic whitetip does not have the highest number of recorded incidents; only 5 recorded attacks as of 2009.[16] [17] In one incident, the torpedoing of USS Indianapolis on 30 July 1945, oceanic whitetips are believed to be responsible for many of the attacks on sailors who survived the initial sinking,[15] though most reportedly died from exposure to the elements rather than from shark attacks.[18]

Also during World War II, the Nova Scotia, a steamship carrying approximately 1,000 people near South Africa, was sunk by a German submarine. With only 192 survivors, many deaths were attributed to the whitetip.[3]

One particularly infamous oceanic whitetip was implicated in several attacks on tourists in the Red Sea near Sharm El Sheikh, Egypt in 2010, and was featured in a Shark Week episode called "Rogue Sharks". This oceanic whitetip was recognized individually by the bite mark taken out of its upper tail lobe. Accumulating evidence revealed this shark to have been conditioned to being hand fed. Upon associating the divers with an easy supply of food, it attacked the divers and snorkelers where it had seen the fish being kept; fanny packs the divers carried. This caused the shark to target the divers' buttock and thigh regions in the hope of obtaining a meal. These attacks were further worsened by the overfishing in that area of the Red Sea, effectively forcing the shark closer to shore where the attacks took place.[19]

Captivity [edit]

As the oceanic whitetip is an open water species, it fares poorly in captivity, like the mako and blue shark. Only one oceanic whitetip is known to reside in captivity, currently housed in the Monterey Bay Aquarium's Outer-Bay exhibit, making the aquarium the only known institution to successfully keep one alive in captivity.[20] This same whitetip was featured briefly in the Shark Week special "Sharks Under Glass".[21]

Conservation status [edit]

In 1969, Lineaweaver and Backus wrote of the oceanic whitetip: "[it is] extraordinarily abundant, perhaps the most abundant large animal, large being over 100 pounds [45 kg], on the face of the earth".[22] There was little further population study until 2003 when the numbers were estimated to have dropped by as much as 70% in the Northwest and Western Central Atlantic between 1992 and 2000.[1] Another study focusing on the Gulf of Mexico, using a mix of data from US pelagic longline surveys from the mid-1950s and observations from the late-1990s, estimated a decline in numbers in this location of 99.3% over this period.[4] However, changes in fishing practices and data collection methods complicate estimates.[23]

As a result of these findings its status on the IUCN Red List was moved to "Vulnerable" globally (from "Lower Risk/Near Threatened") and "Critically Endangered" in the Northwest and Western Central Atlantic areas.[1]

Under the 1995 UN Agreement on the Conservation and Management of Straddling Fish Stocks and Highly Migratory Fish Stocks (UNFSA), coastal and fishing states are specifically required to adopt measures to conserve listed species, but little progress is visible on the oceanic whitetip.[1]

From early 2013 the shark will receive full protection in New Zealand territorial waters under the Wildlife Act 1953.[24][dated info]

See also [edit]

References [edit]

  1. ^ a b c d e f g h i Baum, J., Medina, E., Musick, J. A. & Smale, M. (2005). "Carcharhinus longimanus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 17 June 2012. 
  2. ^ a b c d e Froese, Rainer and Pauly, Daniel, eds. (2013). "Carcharhinus longimanus" in FishBase. February 2013 version.
  3. ^ a b c Bass, A.J., J.D. D'Aubrey & N. Kistnasamy (1973). "Sharks of the east coast of southern Africa. 1. The genus Carcharhinus (Carcharhinidae)." Invest. Rep. Oceanogr. Res. Inst., Durban, no. 33.
  4. ^ a b c Baum, J.K. and Myers, R.A. (2004). "Shifting baselines and the decline of pelagic sharks in the Gulf of Mexico". Ecology Letters 7 (3): 135–45. doi:10.1111/j.1461-0248.2003.00564.x. 
  5. ^ a b c "Carcharhinus longimanus (Poey, 1861)". Integrated Taxonomic Information System. Retrieved 18 August 2008. 
  6. ^ a b c d e f g h i j k Cathleen Bester. "Oceanic Whitetip Shark". Florida Museum of Natural history. Retrieved 22 July 2006. 
  7. ^ a b c d e f g h i j k l Leonard J. V. Compagno (1984). Sharks of the World: An annotated and illustrated catalogue of shark species known to date. Vol. 4, Part 2. Carcharhiniformes. Food and Agriculture Organization of the United Nations. pp. 484–86, 555–61, 588. ISBN 92-5-101383-7. 
  8. ^ Eli. "Fishwatcher". Fishwatcher. Retrieved 6 February 2006. 
  9. ^ Stafford-Deitsch, Jeremy (1988). Shark: A Photographer's Story. Sierra Club Books. ISBN 0871567334. 
  10. ^ "Consideration of Proposals for Amendment of Appendices I and II (CoP15 Prop. 16)". Convention on International Trade in Endangered Species (CITES). March 2010. 
  11. ^ Benchley, Peter (2002). Shark Trouble. Random House. ISBN 0812966333. 
  12. ^ "Online Etymology Dictionary". Retrieved 2006-08-08. 
  13. ^ RF Marx (1990). The History of Underwater Exploration. Courier Dover Publications. p. 3. 
  14. ^ Cousteau, Jacques-Yves & Cousteau, Philippe (1970). The Shark: Splendid Savage of the Sea. Doubleday & Company, Inc. 
  15. ^ a b Martin, R. Aidan. "Elasmo Research". ReefQuest. Retrieved 6 February 2006. 
  16. ^ "ISAF Statistics on Attacking Species of Shark". Flmnh.ufl.edu. 2009-05-20. Retrieved 2010-07-05. 
  17. ^ "Oceanic Whitetip". howstuffworks.com. 
  18. ^ Stanton, Doug (2003). In Harm's Way: The Sinking of the USS Indianapolis and the Extraordinary Story of Its Survivors (1st Owl Books ed.). New York: H. Holt. ISBN 978-0-8050-7366-9. 
  19. ^ Rogue Sharks
  20. ^ "Explore Our History, 2000–2001". Monterey Bay Aquarium. Retrieved 30 March 2013. 
  21. ^ Sharks Under Glass
  22. ^ Thomas H. Lineaweaver III and Richard H. Backus (1969). The Natural History of Sharks. Lippincourt. 
  23. ^ Baum, J.K., Kehler, D. and Myers, R.A. (2005). "Robust estimates of decline for pelagic shark populations in the northwest Atlantic and Gulf of Mexico". Fisheries 30: 27–30. 
  24. ^ "Endangered whitetip sharks to be protected". New Zealand Government. 27 September 2012. Retrieved 27 September 2012. 

Further reading [edit]

  • Leonard J. V. Compagno, Sharks of the Order Carcharhiniformes, Princeton University Press, 1988, ISBN 0-691-08453-X
  • Leonard J. V. Compagno, FAO Species Catalogue, Vol. 4, Parts 1 and 2, Sharks of the World, 1984, Rome: FAO
  • William N. Eschmeyer, Special Publication of the Center for Biodiversity Research and Information, no. 1, vol 1–3, California Academy of Sciences, 1998, ISBN 0-940228-47-5
  • Richard H. Backus, Stewart Springer and Edgar L. Arnold, Jr. A contribution to the natural history of the white-tip shark, Pterolamiops longimanus (Poey), 1956, Deep-Sea Research vol. 3
  • Richard Ellis, The Book of Sharks, 1976, New York: Grosset & Dunlap
  • Reader's Digest, Sharks: Silent Hunters of the Deep, 1989, Sydney: Reader's Digest
  • Froese, Rainer and Pauly, Daniel, eds. (2005). "Carcharhinus longimanus" in FishBase. 09 2005 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!