Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: sharpnose-puffer (English), tamboril (Espanol)
 
Canthigaster amboinensis (Bleeker, 1865)


Ambon sharpnose-puffer,     Spider-eye sharpnose-puffer


Robust, slightly compressed body; head large, blunt; snout long and pointed; 1 pair of small hole-like nostrils; nape with crest between eyes and dorsal fin; eyes high on sides of head; jaws are a beak composed of 4 fused heavy powerful teeth with a central suture on each jaw; a slit-like gill opening in front of the pectoral fin base; a single short- based dorsal fin at rear of body; a similar-shaped anal fin below the dorsal; dorsal 11-12 rays; anal 10-11 rays; pectoral 16-17 rays; no pelvic fins; no spines in the fins; tail fin rounded, with 10 main rays; tough scaleless skin, head and body with scattered tiny spinules, no fleshy skin flaps.



Brown above, shading to white below; body and base of tail with small blue spots, with admixed brown spots on lower sides; head with fine, close blue lines across snout and radiating from eye, mixed with dense blue spots and lines on cheek and opercle.



        Size: 15 cm.

Habitat: reefs.

        

        Depth: 2-15 m.

        Indo-Pacific; vagrant at the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabit shallow water, often subjected to surge. Juveniles secretive and remain in holes of outer reef flat and reef margin (Ref. 37816). Adults on shallow reef flats in high energy zones to about 10 meters depth. Juveniles among small boulders (Ref. 48637). Benthopelagic (Ref. 58302). Feed mainly on algae, but also takes polychaetes, sea urchins, brittle stars, mollusks, tunicates, corals, crustaceans and sponges.
  • Smith, M.M. and P.C. Heemstra 1986 Tetraodontidae. p. 894-903. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4919)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Galapagos Islands, north to southern Japan and Hawaii, south to the Great Barrier Reef and the Society Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands, north to southern Japan, south to Great Barrier Reef (Queensland, Australia), New Caledonia and Society Islands; waifs at the Galápagos I
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 2 (S) - 15 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 12; Analspines: 0; Analsoft rays: 10 - 11
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 15.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 4919))
  • Smith, M.M. and P.C. Heemstra 1986 Tetraodontidae. p. 894-903. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4919)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by brown to orange-brown color on forehead with bluish hue on ventral surface; head with dark brown to blue spots and bands; sides with small blue and blackish spots; depth of body at origin of anal fin 2.3-2.5 in SL; head length 2.4-2.9 in SL; snout length 1.4-1.6 in head length; bony interorbital width 2.6-2.9 in head length; caudal peduncle depth 2.0-2.5 in head length; slightly rounded caudal fin (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits shallower water, often subjected to surge. Feeds mainly on algae, but also takes polychaetes, sea urchins, brittle stars, mollusks, tunicates, corals, crustaceans and sponges.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Canthigaster amboinensis
Catalog Number: USNM 50690
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Year Collected: 1889
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type: Jenkins, O. P. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 485, fig. 32.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Canthigaster amboinensis
Catalog Number: USNM 50885
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: Honolulu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Type: Jordan, D. S. & Evermann, B. W. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 209.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 16 m (Ref. 33390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 31 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 0.7625 - 100
  Temperature range (°C): 25.104 - 29.336
  Nitrate (umol/L): 0.006 - 0.555
  Salinity (PPS): 34.134 - 35.924
  Oxygen (ml/l): 4.454 - 4.807
  Phosphate (umol/l): 0.085 - 0.228
  Silicate (umol/l): 0.829 - 6.035

Graphical representation

Depth range (m): 0.7625 - 100

Temperature range (°C): 25.104 - 29.336

Nitrate (umol/L): 0.006 - 0.555

Salinity (PPS): 34.134 - 35.924

Oxygen (ml/l): 4.454 - 4.807

Phosphate (umol/l): 0.085 - 0.228

Silicate (umol/l): 0.829 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 15m.
From 2 to 15 meters.

Habitat: reef-associated. Spotted toby.  (Bleeker, 1865)  Attains 15 cm. Indo-Pacific and tropical eastern Pacific; in our area east to Durban. Usually found in surge zone down to 9 m. Feeds primarily on coralline red algae and to a lesser extent on corals and benthic inverterbrates. Similar to C. natalensis found in South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on plants and benthic invertebrates (Ref. 13550).
  • Randall, J.E. 1985 Guide to Hawaiian reef fishes. Harrowood Books, Newtown Square, PA 19073, USA. 74 p. (Ref. 3921)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Omnivore

Diet: benthic microalgae, mobile benthic worms, sea-stars/cucumbers/urchins, sponges/seasquirts/bryozoa, soft corals/hydroids, sessile crustacea, sessile worms, sessile molluscs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canthigaster amboinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAACTCAGCCAACCCGGCGCACTTCTAGGTGACGACCAAATTTATAATGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGCGGCTTTGGAAACTGGCTAGTGCCCCTTATAATTGGAGCGCCCGACATGGCCTTCCCTCGAATAAATAATATAAGTTTCTGACTGCTACCCCCCTCTTTCCTACTCCTTCTGGCATCTTCCGGCGTAGAAGCTGGGGCCGGTACAGGCTGAACAGTCTACCCACCACTAGCAGGCAACCTAGCCCACGCAGGAGCCTCTGTCGACCTCACAATTTTCTCCCTCCACCTAGCAGGTGTTTCATCAATTCTAGGCGCTATCAACTTTATTACTACAATTATTAACATGAAACCTCCAGCCATCTCTCAATACCAGACCCCGCTCTTCGTATGGGCTGTCCTAATCACTGCTGTCCTGCTACTGTTATCACTACCAGTTCTCGCAGCCGGAATTACAATACTTCTCACAGACCGAAACCTAAACACCACCTTTTTTGACCCTGCGGGAGGAGGAGACCCCATTCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Canthigaster amboinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!