Articles on this page are available in 2 other languages: Spanish (1), Dutch (1) (learn more)

Overview

Brief Summary

Sunfish have a bizarre appearance. The best way to describe them is with the term 'swimming head'. Every once in awhile, a sunfish is caught in the North Sea, or one is washed ashore. It is usually a small, young specimen weighing around 50 kilograms. Sunfish have a relatively long life expectancy and keep growing their entire life. There have been reports of sunfish 4 meters long and 2300 kilograms. Sunfish have two world records. They are the heaviest known bony fish and they lay the most eggs. They are even mentioned in the Guinness Book of World Records.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Molas are distinguished for their distinct morphological characters which include reduced/fused caudal elements, presence of a clavus in place of the caudal fin, absence of a swim bladder and a degenerate, cartilaginous skeleton (Ref. 86435). Adults are found on slopes adjacent to deep water where they come in for shelter and for seeking cleaner fishes. They are usually shy. However, they may become familiar with divers in some locations (Ref. 48637). Individuals often drift at the surface while lying on its side but can swim actively and are capable of directional movements otherwise (Ref. 86435). They swim upright and close to the surface. The dorsal fin often protrudes above the water. Females are larger than males (Ref. 86435). This species has been filmed in 480 m depth with the help of a camera equipped with baits (Lis Maclaren, pers. comm. 2005). Adults eat fishes, mollusks, zooplankton, jellyfish, crustaceans and brittle stars (Ref. 4925, 5951, 48637). A live colony of the cirripede Lepas anatifera were found attached to the anterior portion of the sunfish's esophagus that was stranded in the south coast of Terceira Island, Azores Archipelago in 2004. This association has apparent advantages for the goose barnacles such as a regular intake of food and protection both from hydrodynamic hazards and from predators: but for the sunfish, it is not clear whether it is neutral, of advantage or causes feeding problems since the attachment may obstruct the sunfish's esophagus (Ref. 55063). The sunfish is registered as the heaviest bony fish and as the one with the most eggs in the Guinness Book of World Records (Ref. 6472). Generally this species is not used as food fish; some people consider it as a delicacy (Ref. 30573). The fish can be utilized fresh and can be broiled (Ref. 9988). Some parts of the fish are used in Chinese medicine (Ref. 12166). Molas may contain the same toxin as puffers and porcupine fish (Ref. 13513). They do not adapt well in captivity (Ref. 12382, 37040). Juveniles are victims of California sea lions in Monterey Bay (Ref. 37040).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Silvery to brownish grey in colour. Body short and tall, flattened like a disc. Ventral fins absent. Caudal fin replaced by a stiff fringe of skin. Dorsal and anal fins modified to form long 'paddles' that can only move from side to side. Skin leathery without scales. Small eyes and mouth. May grow up to 4 m in length and 2 tonnes in weight.Often seen drifting at the surface while on its side or close to the surface with its dorsal fin projecting out of the water. Feeds on zooplankton, jellyfish, eel larvae and small deep sea fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Sunfish belong to the same group of fish as the pufferfish (Molidae). Members of this group have small mouths with beak-like teeth. The body is short and tall and flattened from side to side. The most striking characteristic of this species is the apparent absence of a tail as this is reduced to a stiff, frill-like membrane. In most fish the tail fin is the main means of propulsion, however in the sunfish the dorsal and anal fins are modified to form long 'paddles' which move from side to side. The upper half and fins are dark blue or grey-brown and the underside is silvery-white. This is one of the largest open water fish growing to a maximum length of approximately 3m. This species resembles the slender sunfish (Ranzania laevis) however this species is very rare in the seas around Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: sunfish (English), mola (Espanol), pez-sol (Espanol)
 
Mola mola (Linnaeus, 1758)


Ocean sunfish


Body a deep oval (depth usually ~ length), strongly compressed; mouth a horizontal slit when closed, opens at the front, is a beak (without a central suture) composed of teeth fused to the jaws; gill openings small, on side just before pectorals; pectorals short, rounded; no pelvics; dorsal 17-18 rays; anal 14-18 rays; pectoral 12-13 rays; no tail base;  dorsal and anal fins long and high, symmetrical, used for locomotion, at rear of body, their rear rays joined to tail fin immediately behind them that is reduced to a vertically elongate, short, blunt rudder, with bony ossicles on its margin, with an undulating rounded profile; skin thick, tough, with small denticles.

Grey brown to dark blue above, often with large pale blotches, silvery below, fins dark.

Size: 332 cm.

Habitat: oceanic.


Depth near surface, 0-644 m.


        Circumglobal, tropical to warm temperate; off Baja and the Gulf of California, and the Galapagos; potentially throughout our region.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, European waters (ERMS scope), FAO fishing area 67, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, Kenya, Madagascar, Mozambique, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, Portuguese Exclusive Economic Zone, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Warm and temperate zones of all oceans. Eastern Pacific: British Columbia, Canada (Ref. 2850) to Peru and Chile (Ref. 5530). Western Pacific: Japan to Australia (Ref. 86345). Eastern Atlantic: Scandinavia to South Africa (occasionally western Baltic, Mediterranean). Western Atlantic: Newfoundland, Canada (Ref. 7251) to Argentina (Ref. 36453).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ocean sunfish, Mola mola, are found in the temperate and tropical regions of the Mediterranean, Atlantic, Indian, and Pacific Oceans (Wheeler, 1969; Sims and Southall, 2002; Houghton et al., 2006). They are commonly observed off the coast of Southern California, Indonesia, the British Isles, the Northern and Southern Isles of New Zealand, the southern coasts of Africa, and in the Mediterranean and occasionally in the North Sea (Muus, 1964; Ayling and Cox, 1982; Smith, 1965; Cartamil and Lowe, 2004; Houghton et al., 2006; Sims and Southall, 2002; Konow et al., 2006). Most sightings in the British Isles and North Sea occur during the summer months, particularly June and July, when the waters are between 13 and 17˚C (Sims and Southall, 2002). Ocean sunfish are thought to migrate to higher latitudes during the spring and summer months to pursue their migrating zooplankton prey (Liu et al., 2009).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

  • Ayling, T., G. Cox. 1982. Collins Guide to Sea Fishes of New Zealand. Auckland: William Collins Publishers LTD.
  • Cartamil, D., C. Lowe. 2004. Diel movement patterns of Ocean Sunfish Mola mola off Southern California. Mar. Ecol. Prog. Ser., 266: 245-253.
  • Houghton, J., T. Doyle, J. Davenport, G. Hays. 2006. The ocean sunfish Mola mola: insights into distribution, abundance and behaviour in the Irish and Celtic Seas. Journal of the Marine Biological Association of the United Kingdom, 86/5: 1237-1243.
  • Konow, N., R. Fitzpatrick, A. Barnett. 2006. Adult Emperor Angelfish (Pomecanthus imperator) clean Giant sunfishes (Mola mola) at Nusa Lembongan, Indonesia. Coral Reefs, 25/2: 208.
  • Liu, K., M. Lee, S. Joung, Y. Chang. 2009. Age and growth estimates of the sharptail mola, Masturus lanceolatus,in waters of eastern Taiwan. Fisheries Research, 95/2-3: 154-160.
  • Muus, B. 1964. . Collins Guide to the Sea Fishes of Britain and North-Western Europe. London: Collins Clear-Type Press.
  • Sims, D., E. Southall. 2002. Occurrence of ocean sunfish, Mola mola near fronts in the western English Channel. Journal of the Marine Biological Association of the UK, 82/5: 927-928.
  • Smith, J. 1965. The Sea Fishes of Southern Africa. South Africa: Central News Agency, LTD.
  • Wheeler, A. 1969. The Fishes of the British Isles and North-West Europe. Michigan: Michigan State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Newfoundland to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through temperate seas (including western Baltic Sea, North Sea, Mediterranean Sea, Mascarenes, Red Sea, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tropical and temperate seas; northward to northern Norway in the eastern Atlantic, to the Newfoundland banks, the Gulf of St. Lawrence, and the coast of Nova Scotia in the western Atlantic.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Tortonese, E., 1990; Clemens, W. A. and G. V. Wilby, 1961; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The sunfish is distributed throughout the world in warm and temperate seas. In the British Isles they are mostly encountered late in the summer around August and September.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 644 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 15 - 18; Analspines: 0; Analsoft rays: 14 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Ocean sunfish have a large body that is compressed and ovular. They are the largest bony fish, measuring up to 3.1 m in length, 4.26 m in height, and weighing up to 2235 kg (Hutchins, 2004; Humann and Deloach, 2002; Houghton et al., 2006). They are scale-less, and have a thick, rubbery skin and irregular patches of tubercles over their body (Hutchins, 2004; Wheeler, 1969; Smith, 1965). Notably, adult ocean sunfish do not have a caudal fin or caudal peduncle. They instead have a clavus, which is a truncated tail, used more like a rudder than for propulsion. The clavus reaches from the rear edge of the dorsal fin to the rear edge of the anal fin (Wheeler, 1969; Hutchins, 2004; Linnaeus, 1758). The dorsal and anal fins of ocean sunfish are tall, and their small pectoral fins point toward the dorsal fin (Hutchins, 2004). The dorsal fin has 15 to 18 soft rays, and the anal fin has 14 to 17 soft rays (Hutchins, 2004). They also have a small mouth with fused teeth that form a beak-like structure (Hutchins, 2004).

Ocean sunfish vary in coloration, though the head, back, tips of the anal and dorsal fins, and clavus are generally a mixture of dark grey-brown and dark silvery grey (Hutchins, 2004; Humann and Deloach, 2002; Ayling and Collins, 1982). They have a white belly and sometimes have white splotches on their fins and dorsal side (Ayling and Collins, 1982; Humann and Deloach, 2002). Adult ocean fish do not possess a lateral line, and only one gill opening is visible on each side, which is located near the base of the pectoral fins (Hutchins, 2004; Smith and Heemstra, 1986).

Range mass: 2235 (high) kg.

Range length: 3.1 (high) m.

Other Physical Features: ectothermic ; bilateral symmetry

  • Linnaeus, C. 1758. Sistema Naturae, 10th Edition.
  • Smith, M., P. Heemstra. 1986. Smith’s Sea Fishes. Berlin: Springer-Verlag.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 332.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3330 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

333 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 2,300.0 kg (Ref. 47360)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 332 cm TL (male/unsexed); max. weight: 2,000 kg.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Tortonese, E., 1990; Clemens, W. A. and G. V. Wilby, 1961; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The scaleless body is covered with extremely thick, elastic skin. The caudal fin is replaced by a rudder-like structure called 'clavus'. Dorsal and anal fins very high with short base; in swimming, these fins are flapped synchronously from side to side and can propel the fish at surprisingly good speed. Pectorals small and rounded, directed upward (Ref. 6885). Mouth very small; teeth fused to form a parrot-like beak. Gills 4, a slit behind the last; gill openings reduced to a small hole at the base of the pectoral fins. Gas bladder absent in adults.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

It often drifts at the surface while lying on its side, or swims upright and so close to the surface that the dorsal fin projects above the water. Sometimes reaches depths of up to 300 m (Ref. 9317). Feeds on animal plankton, eel larvae, small deep-sea fishes; also on jellyfish, crustaceans, molluscs, and brittlestars (Ref. 4925). In Guiness Book of Records it was recorded as the heaviest bony fish and as the one with the most eggs (Ref. 6472). Also occasionally caught with encircling nets (Ref. 9119) and harpoon (Ref. 9988). Mola is the latin word for millstone. Utilized fresh and can be broiled (Ref. 9988).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 30 - 480 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adult ocean sunfish are found in temperate and tropical oceans across the globe. They prefer the open ocean but occasionally venture into kelp beds and deep coral reefs in order to be cleaned of parasites by fishes such as wrasses (Labroides dimidiatus and Thalasoma lunare) and Emperor Angelfish (Hutchins, 2004; Humann and Deloach, 2002, Konow et al., 2006).

Habitat Regions: saltwater or marine

Aquatic Biomes: pelagic

  • Humann, P., N. Deloach. 2002. Odd-Shaped Swimmers. Pp. 419 in Reef Fish Identification of Florida, Caribbean, Bahamas, Vol. 2, 3rd Edition. Jacksonville: New World Publicators, Inc..
  • Hutchins, M. 2004. Tetraodontiformes. Pp. 477-478 in Grzimek’s Animal Life Encyclpedia, Vol. 5 fishes II, 2nd Edition. Detroit: Thompson Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in warm and temperate seas, often drifting on the surface.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3553 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2881 samples.

Environmental ranges
  Depth range (m): 0 - 2450
  Temperature range (°C): 3.126 - 26.831
  Nitrate (umol/L): 0.119 - 26.285
  Salinity (PPS): 30.381 - 36.508
  Oxygen (ml/l): 4.081 - 7.599
  Phosphate (umol/l): 0.045 - 1.609
  Silicate (umol/l): 0.565 - 25.103

Graphical representation

Depth range (m): 0 - 2450

Temperature range (°C): 3.126 - 26.831

Nitrate (umol/L): 0.119 - 26.285

Salinity (PPS): 30.381 - 36.508

Oxygen (ml/l): 4.081 - 7.599

Phosphate (umol/l): 0.045 - 1.609

Silicate (umol/l): 0.565 - 25.103
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Distributed throughout the world in tropical and temperate seas in open water to a depth of at least 360 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 300m.
Recorded at 300 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; marine; depth to 300 m. Seen drifting at the surface lying on its side, or swimming upright near the surface so its dorsal fin projects above the water.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Tortonese, E., 1990; Clemens, W. A. and G. V. Wilby, 1961; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sunfish live in open water and are usually spotted swimming or drifting at the surface of the water. They mostly feed on planktonic animals, especially jelly-fish, salps and comb-jellies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The fish is found on slopes adjacent to deep water. The fish comes in for shelter and for seeking cleaner fishes. The fish is usually shy. However, it may become familiar with divers in some locations (Ref. 48637). The species often drifts at the surface while lying on its side. It swims upright and close to the surface. The dorsal fin often protruds above the water. The species has been filmed in 480 m depth with the help of a camera equipped with baits(Lis Maclaren, pers. Comm. 2005). The species eats fishes, mollusks, zooplankton, jellyfish, crustaceans and brittle stars (Ref. 4925, 48637). A live colony of the cirriped Lepas anatifera were found attached to the anterior portion of the sunfish's esophagus that was stranded in the south coast of Terceira Island, Azores Archipelago in 2004; an association with apparent advantages for the goose barnacles such as a regular intake of food and protection both from hydrodynamic hazards and from predators: but for the sunfish, it is not clear whether it is neutral, of advantage or causes feeding problems since the attachment may obstruct the sunfish's esophagus (Ref. 55063). Parasites of the species include 1 monogenean, 6 trematodes, 3 cestodes and 4 copepods (Ref. 5951). The fish is registered as the heaviest bony fish and as the one with the most eggs in the Guinness Book of World Records (Ref. 6472).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Ocean sunfish primarily feed on jellyfish and gelatinous zooplankton, such as ctenophores, salps, and medusae. They have also been known to eat soft bodied invertebrates, crustaceans, mollusks, seaweed, eel larvae, and even flounder (Wheeler, 1969). Ocean sunfish are thought to migrate to higher latitudes in response to zooplankton migrations during the spring and summer months (Liu et al., 2009). They may also migrate vertically during the day to prey upon jellyfish and zooplankton found below the thermocline (Cartamil and Lowe, 2004; Liu et al., 2009).

Animal Foods: fish; mollusks; aquatic crustaceans; cnidarians; zooplankton

Plant Foods: macroalgae

Primary Diet: herbivore (Algivore); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fishes, mollusks, zooplankton, jellyfish, crustaceans, and brittle stars.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Tortonese, E., 1990; Clemens, W. A. and G. V. Wilby, 1961; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, pelagic jellyfish/ctenophores, zooplankton, pelagic fish larvae, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Ocean sunfish are considered to have strategic top-down control of jellyfish populations. They may also have a direct influence on the incidence and occurrence of jellyfish blooms (Liu et al., 2009).

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Ocean sunfish are often preyed upon by large sharks and California sea lions (Cartamil and Lowe, 2004). They may dive below the thermocline to avoid predators (Cartamil and Lowe, 2004). Ocean sunfish are also occassionally hunted by humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mola mola (ocean sunfish) is prey of:
Chondrichthyes

Based on studies in:
unknown (epipelagic zone, Tropical)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mola mola (ocean sunfish) preys on:
Copepoda

Based on studies in:
unknown (epipelagic zone, Tropical)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Sims et al. (2009) used a fast-acquisition global positioning system (Fastloc GPS) tag with remote data retrieval to track long-term movements of three Ocean Sunfish (Mola mola) captured and tagged off southern Portugal. This allowed tracking in near real time with position accuracy of <70 m. These fish are known to dive to depths of at least 472 m and can often remain at deep depths for long periods, only returning occasionally, and then often only briefly, to the surface. The system implemented permitted reception and transmission of location information whenever the fish came close to the surface.

According to Sims et al., their study represents the first demonstration of long-term (>90 days) GPS tracking of a large pelagic fish and shows the great potential for this technique, whereby GPS-quality location data are retrieved remotely via conventional Argos satellites. By freeing researchers from the restriction of working on estuarine or nearshore species in order to physically recover tags to download GPS acquisition data, this technique offers tremendous potential for tracking large pelagic fish species that surface relatively frequently. Although the high spatial accuracy of this technique for fish in open ocean habitats has practical applications for both fisheries and conservation, it will not be suitable for fish species that remain in deep water after tagging.

In the early part of the 20th Century, Ocean Sunfish were sometimes described as active swimmers, but in other cases described as sluggish, inefficient swimmers, passively carried by ocean currents. Modern tracking studies of these fish using attached acoustic transmitters, acceleration dataloggers, and satellite-linked archival transmitters have demonstrated that they are active swimmers both horizontally and vertically. Sims et al. (2009) found that the Ocean Sunfish they tracked covered around 10 to 20 km per day, a rate that is comparable to the movements of pelagic sharks. GPS track integration with current direction/strength maps showed individuals often headed into and across prevailing currents associated with mesoscale eddies. These data confirm that Ocean Sunfish are not passive drifters, but rather, are in fact active swimmers with movement rates within the range observed for other pelagic fishes. Search-like movements occurred over at least three distinct spatial scales. At fine scales, Ocean Sunfish spent longer in highly localised areas with faster, straighter excursions between them. These "stopovers" during long-distance movement appear consistent with finding and exploiting food patches.

Sims et al. (2009) suggest that there would be great value in pursuing long-term GPS tracking of other large pelagic fish species--such as tunas, billfish, and sharks--that surface relatively frequently and have high conservation priority in many ocean regions where a greater understanding of when and why they use certain habitats could enhance management.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known regarding methods of communication and perception of ocean sunfish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Produces very numerous and small eggs; 300 million eggs found in a 1.5 m long female (Ref. 4711). Oocytes in the ovaries develop in different stages suggesting Mola mola as a multiple spawner (Ref. 86440). This is the largest clutch estimate for this species (Ref. 53596).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Ocean sunfish have two larval stages. Larvae in the first tetradon-like stage are round and spines protrude from the edges of their body. They have a well-developed tail and caudal fin (Bass et al., 2005; Muus, 1964) During the second larval stage, the tail is completely absorbed and spines disappear (Bass et al., 2005). Larvae generally measure about 0.25 cm in length (Pope et al., 2010). Juvenile ocean sunfish grow at an considerable rate, averaging 0.02 to 0.42 kg/day and sometimes reaching 0.82 kg/day (Pope et al., 2010).

  • Bass, A., H. Dewar, T. Thys, J. Streelman, S. Karl. 2005. Evolutionary Divergence among lineages of the Ocean Sunfish family, Molidae (Tetraodontiformes). Marine Biology, 148: 405-414.
  • Pope, E., G. Hays, T. Thys, T. Doyle, D. Sims, N. Queiroz, V. Hobson, L. Kubicek, J. Houghton. 2010. The biology and ecology of the ocean sunfish Mola mola: a review of current knowledge and future research perspectives. Reviews in Fish Biology and Fisheries, 20/4: 471-487.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of ocean sunfish is currently unknown. A member of the same family, sharptail mola are estimated to have a lifespan of 82 to 105 years (Liu et al., 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Very little is known about the longevity of sunfishes, though given their their large body size and reproductive output it is possibly they are long-lived. They can lay 300,000,000 eggs. Anecdotes suggest they can live more than 10 years in captivity, but possibly much longer (http://www.oceansunfish.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Little is known about the mating systems of ocean fish, although they are thought to have paired courtship (Muus,1964; Hutchins, 2004). Some individuals are thought to spawn in the Sargasso Sea.

Little is known about the breeding behaviors of ocean sunfish. Off the coast of Japan, spawning is thought to occur between August and October (Nakatsubo et al., 2007). Female ocean sunfish can produce over 300 million eggs each breeding season, making them the most fecund extant vertebrate (Bass et al., 2005). Their eggs are very small, with an average diameter of 0.13 cm (Pope et al., 2010).

Range number of offspring: 300,000,000 (high) .

Little is known regarding parental investment of offspring in ocean sunfish.

  • Bass, A., H. Dewar, T. Thys, J. Streelman, S. Karl. 2005. Evolutionary Divergence among lineages of the Ocean Sunfish family, Molidae (Tetraodontiformes). Marine Biology, 148: 405-414.
  • Hutchins, M. 2004. Tetraodontiformes. Pp. 477-478 in Grzimek’s Animal Life Encyclpedia, Vol. 5 fishes II, 2nd Edition. Detroit: Thompson Gale.
  • Muus, B. 1964. . Collins Guide to the Sea Fishes of Britain and North-Western Europe. London: Collins Clear-Type Press.
  • Nakatsubo, T., M. Kawachi, N. Mano, H. Hirose. 2007. Spawning Period of Ocean Sunfish Mola mola in water of the eastern Kanto region, Japan. Aquaculture Science, 55/4: 613-618.
  • Pope, E., G. Hays, T. Thys, T. Doyle, D. Sims, N. Queiroz, V. Hobson, L. Kubicek, J. Houghton. 2010. The biology and ecology of the ocean sunfish Mola mola: a review of current knowledge and future research perspectives. Reviews in Fish Biology and Fisheries, 20/4: 471-487.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Numerous and small eggs (300 million in a female 1.5 m long). Three developmental stages : (1) tetraodontiform-body rather elongate, no spines, caudal fin present;(2) ostracioniform-body shortened, with some large spines on body plates;(3) molacanthiform (Molacanthus)-body short and high, skin rough with minute spines.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Tortonese, E., 1990; Clemens, W. A. and G. V. Wilby, 1961; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Tissue provides neutral buoyancy: ocean sunfish
 

The thick layer of low-density, subcutaneous tissue of the ocean sunfish enables rapid depth changes by having a incompressible, gelatinous composition.

   
 

‘It was demonstrated that despite the missing swim-bladder, ocean sunfish are neutrally buoyant (mean body density 1,027 ± 4 kg/m3, N = 20) in seawater (density ca. 1,026 kg/m3) and that a thick layer of low-density, subcutaneous, gelatinous tissue plays a major role providing this buoyancy (Watanabe and Sato 2008). The degenerate, cartilaginous skeleton of M. mola (…) also likely contributes to buoyancy (…). Importantly, the gelatinous tissue is incompressible, enabling rapid depth changes without the changes in buoyancy that would be experienced by fish possessing swim-bladders (…). This combination of a lift-based swimming mode [This results from the one-stroke cycle movement of the dorsal and anal fins that effectively act as a pair of vertical hydrofoils. The presence of active swimming appendages that are not bilaterally symmetrical is another unique and interesting characteristic of the ocean sunfish] and neutral buoyancy from incompressible, gelatinous tissue appears to allow M. mola to move over considerable distances, despite its unusual morphology.’ (Pope 2010: 7).

[The gelatinous layer in ocean sunfishes has a thickness ranging from 3.9 cm (2 kg individuals) to 21.0 cm (959 kg individuals) and a mean density of 1,015 kg/m3. It may account for 26 % to 44% of the body mass and supports from 69% to100% of the fish weight in water. Watanabe and Sato 2008: 3]


  Learn more about this functional adaptation.
  • Pope EC; Hays GC; Thys TM; Doyle TK; Sims DW; Queiroz N; Hobson VJ; Kubicek L; Houghton JDR. 2010. The biology and ecology of the ocean sunfish Mola mola: a review of current knowledge and future research perspectives. Reviews in Fish Biology and Fisheries DOI 10.1007/s11160-009-9155-9.
  • Watanabe Y; Sato K. 2008. Functional dorsoventral symmetry in relation to lift-based swimming in the ocean sunfish Mola mola. 3(10): e3446.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mola mola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACACGCTGATTTTTCTCAACCAACCATAAAGATATCGGCACCCTTTATTTAGTATTCGGTGCATGAGCCGGGATAGTGGGGACGGCCTTAAGCCTACTCATTCGAGCGGAACTAAGTCAACCTGGCGCTCTTCTTGGAGACGACCAAATTTACAATGTCATCGTCACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGGGGCTTCGGAAACTGGCTGATCCCTCTTATGATTGGGGCCCCCGATATGGCCTTCCCCCGAATGAATAATATGAGCTTTTGACTCTTACCCCCCTCTTTTCTTCTCCTTCTTGCCTCCTCAGGCGTCGAAGCAGGTGCTGGAACAGGATGAACTGTATACCCCCCTTTAGCCGGAAACTTAGCCCACGCAGGCGCCTCTGTTGATTTAACAATCTTTTCCCTTCACCTAGCCGGTATCTCCTCAATTCTAGGGGCCATTAATTTTATCACAACAATTATTAACATGAAACCGCCTGCAATTTCGCAATACCAAACCCCCCTGTTTGTATGGGCAGTCCTCATTACGGCAGTACTTCTTCTCCTATCGCTTCCAGTTCTTGCAGCCGGAATCACGATGCTTCTTACAGATCGAAACCTTAACACCACCTTCTTCGACCCGGCAGGAGGAGGGGACCCAATCCTGTATCAACATCTCTTCTGATTCTTCGGCCATCCTGAAGTTTACATTCTCATTCTTCCAGGGTTCGGTATAATTTCACACATTGTTGCTTATTACTCAGGTAAAAAAGAGCCCTTTGGCTATATGGGCATGGTTTGGGCAATGATGGCCATCGGCCTTTTAGGATTTATTGTATGAGCCCACCATATGTTTACAGTCGGAATAGACGTAGATACACGAGCATACTTTACCTCTGCCACAATAATTATCGCCATCCCAACAGGTGTCAAAGTCTTTAGCTGATTAGCCACTCTGCACGGAGGGTCTATCAAGTGGGAGACTCCACTCTTGTGAGCCCTCGGCTTTATTTTCCTATTCACAGTAGGAGGCCTCACCGGAATTGTCCTAGCTAATTCTTCCCTTGACATTGTGCTACATGACACATATTATGTAGTAGCTCACTTCCATTATGTCTTATCAATGGGGGCCGTCTTTGCTATTATGGGGGCTTTCGTCCACTGATTCCCCTTATTCTCAGGATATACCCTCCACGGCACTTGAACAAAAATCCACTTTGGAGTGATATTTGTAGGGGTGAATTTAACTTTCTTCCCGCAACACTTCTTAGGCCTTGCTGGGATGCCCCGTCGGTACTCAGACTATCCAGACGCTTATACCCTCTGAAACACTGTTTCATCAATTGGATCACTAATTTCACTTGTAGCCGTAATTATATTCCTATTCATTCTATGAGAAGCATTCGCCGCCAAACGTGAAGTTCTCTCGGTAGAGCTTACCACAACTAACGTTGAATGACTACATGGCTGCCCCCCTCCCTATCACACATTTGAAGAACCTGCCTTTGTTCAAGTCCGATCAACGAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mola mola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Ocean sunfish have not been evaluated by the IUCN, US Federal List, or CITES. They are often caught as bycatch by drift gillnet fisheries. In southern California, ocean sunfish compromised 29% of the catch in drift gillnet fisheries targeting swordfish (Cartamil and Lowe, 2004). In the Mediterranean between 1992 and 1994, ocean sunfish had a bycatch rate of 70 to 93%. In South Africa, the bycatch rate of ocean sunfish is estimated at 17% (Liu et al., 2009).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
  • Bauchot, M.-L. 1987 Poissons osseux. p. 891-1421. In W. Fischer, M.L. Bauchot and M. Schneider (eds.) Fiches FAO d'identification pour les besoins de la pêche. (rev. 1). Méditerranée et mer Noire. Zone de pêche 37. Vol. II. Commission des Communautés Européennes and FAO, Rome. (Ref. 3397)   http://www.fishbase.org/references/FBRefSummary.php?id=3397&speccode=2504 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Ocean sunfish are often caught as bycatch in commercial fishing nets, which can be a great inconvenience (Liu et al., 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Ocean sunfish are considered a delicacy in some Asian countries. They are also used in traditional Chinese medicines (Humann and Deloach, 2002).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ocean sunfish

The ocean sunfish, Mola mola, or common mola, is the heaviest known bony fish in the world. It has an average adult weight of 1,000 kg (2,200 lb). The species is native to tropical and temperate waters around the globe. It resembles a fish head with a tail, and its main body is flattened laterally. Sunfish can be as tall as they are long when their dorsal and ventral fins are extended.

Sunfish live on a diet that consists mainly of jellyfish, but because this diet is nutritionally poor, they consume large amounts in order to develop and maintain their great bulk. Females of the species can produce more eggs than any other known vertebrate.[1] Sunfish fry resemble miniature pufferfish, with large pectoral fins, a tail fin and body spines uncharacteristic of adult sunfish.

Adult sunfish are vulnerable to few natural predators, but sea lions, orcas and sharks will consume them. Among humans, sunfish are considered a delicacy in some parts of the world, including Japan, the Korean peninsula and Taiwan. In the EU, regulations ban the sale of fish[2] and fishery products[3] derived of the Molidae family. Sunfish are frequently, though accidentally, caught in gillnets.

A member of the order Tetraodontiformes, which also includes pufferfish, porcupinefish and filefish, the sunfish shares many traits common to members of this order. It was originally classified as Tetraodon mola under the pufferfish genus, but it has since been given its own genus, Mola, with two species under it. The ocean sunfish, Mola mola, is the type species of the genus.

Contents

Naming and taxonomy [edit]

A sunfish caught in 1910, with an estimated weight of 1600 kg (3500 lb)
Sunfish, Lisbon Oceanarium 2009 (Video)

Many of the sunfish's various names allude to its flattened shape. Its specific name, mola, is Latin for "millstone", which the fish resembles because of its grey colour, rough texture, and rounded body. Its common English name, sunfish, refers to the animal's habit of sunbathing at the surface of the water. The Dutch-, Portuguese-, French-, Catalan-, Spanish-, Italian-, Russian- and German-language names, respectively maanvis, peixe lua, poisson lune, peix lluna, pez luna, pesce luna, рыба-луна and Mondfisch, mean "moon fish", in reference to its rounded shape. In German, the fish is also known as Schwimmender Kopf, or "swimming head". In Polish it is named samogłów, meaning "head alone", because it has no true tail. The Chinese translation of its academic name is fan-che yu 翻車魚, meaning "toppled car fish". The ocean sunfish has various superseded binomial synonyms, and was originally classified in the pufferfish genus, as Tetraodon mola.[4][5] It is now placed in its own genus, Mola, with two species: Mola mola and Mola ramsayi. The ocean sunfish, Mola mola, is the type species of the genus.[6]

The Mola genus belongs to the Molidae family. This family comprises 3 genera: Masturus, Mola and Ranzania. The common name "sunfish" without qualifier is used to describe the Molidae marine family as well as the freshwater sunfishes in the family Centrarchidae which are unrelated to Molidae. On the other hand, the name "ocean sunfish" and "mola" refer only to the family Molidae.[1]

The Molidae family belongs to the order Tetraodontiformes, which includes pufferfish, porcupinefish and filefish. It shares many traits common to members of this order, including the four fused teeth that form the characteristic beak and give the order its name (tetra=four, odous=tooth, and forma=shape). Indeed, sunfish larvae resemble spiky pufferfish more than they resemble adult molas.[7]

Description [edit]

A taxidermied ocean sunfish, caught in 1890 off the former Austrian Adriatic coast.

The caudal fin of the ocean sunfish is replaced by a rounded clavus, creating the body's distinct truncated shape. The body is flattened laterally, giving it a long oval shape when seen head-on. The pectoral fins are small and fan-shaped, while the dorsal fin and the anal fin are lengthened, often making the fish as tall as it is long. Specimens up to 3.2 m (10.5 ft) in height have been recorded.[8]

A drawing of an ocean sunfish from 1887.

The mature ocean sunfish has an average length of 1.8 m (5.9 ft), a fin-to-fin length of 2.5 m (8.2 ft) and an average weight of 1,000 kg (2,200 lb),[1] although individuals up to 3.3 m (10.8 ft) in length[8] 4.2 m (14 ft) across the fins[9] and weighing up to 2,300 kg (5,100 lb)[10] have been observed.

The spinal column of M. mola contains fewer vertebrae and is shorter in relation to the body than that of any other fish.[11] Although the sunfish descended from bony ancestors, its skeleton contains largely cartilaginous tissues, which are lighter than bone, allowing it to grow to sizes impractical for other bony fishes.[11][12] Its teeth are fused into a beak-like structure,[10] and pharyngeal teeth located in the throat.[13]

The sunfish lacks a swim bladder.[11] Some sources indicate that the internal organs contain a concentrated neurotoxin, tetrodotoxin, like the organs of other poisonous tetraodontiformes,[10] while others dispute this claim.[14]

Fins [edit]

A partial skeleton, showing the structure of the fins

In the course of its evolution, the caudal fin (tail) of the sunfish disappeared, to be replaced by a lumpy pseudo-tail, the clavus. This structure is formed by the convergence of the dorsal and anal fins.[15][16] The smooth-denticled clavus retains twelve fin rays, and terminates in a number of rounded ossicles.[17] Without a true tail to provide thrust for forward motion and equipped with only small pectoral fins, Mola mola relies on its long, thin dorsal and anal fins for propulsion, driving itself forward by moving these fins from side to side.[18][citation needed]

Ocean sunfish often swim near the surface, and their protruding dorsal fins are sometimes mistaken for those of sharks.[19] However, the two can be distinguished by the motion of the fin. Sharks, like most fish, swim by moving the tail sideways while keeping the dorsal fin stationary. The sunfish, on the other hand, swings its dorsal fin and anal fin in a characteristic sculling motion which can be used to identify it.[20]

Skin [edit]

M. mola in typical swimming position

Adult sunfish range from brown to silvery-gray or white, with a variety of mottled skin patterns; some of these patterns may be region-specific.[1] Colouration is often darker on the dorsal surface, fading to a lighter shade ventrally as a form of counter-shading camouflage. Mola mola also exhibits the ability to vary skin colouration from light to dark, especially when under attack.[1] The skin, which contains large amounts of reticulated collagen, can be up to 3 in (7.6 cm) thick on the ventral surface, and is covered by denticles and a layer of mucus instead of scales. The skin on the clavus is smoother than that on the body, where it can be as rough as sandpaper.[11]

More than 40 species of parasites may reside on the skin and internally, motivating the fish to seek relief in a number of ways.[1][17] In temperate regions, drifting kelp fields harbour cleaner wrasses and other fish which remove parasites from the skin of visiting sunfish. In the tropics, the mola solicits cleaning help from reef fishes. By basking on its side at the surface, the sunfish also allows seabirds to feed on parasites from its skin. Sunfish have been reported to breach, clearing the surface by more than three body lengths, possibly as another effort to dislodge parasites.[19][21]

Range and behavior [edit]

M. mola exhibiting its characteristic horizontal basking behaviour

Ocean sunfish are native to the temperate and tropical waters of every ocean in the world.[11] Mola genotypes appear to vary widely between the Atlantic and Pacific, but genetic differences between individuals in the northern and southern hemispheres are minimal.[22]

Although early research suggested that sunfish moved around mainly by drifting with ocean currents, individuals have been recorded swimming 26 km in a day, at a top speed of 3.2 km/h.[23] Sunfish are pelagic and swim at depths of up to 600 m (2,000 ft). Contrary to the general perception that sunfish spend much of their time basking at the surface, research suggests that adult M. mola actually spend a large portion of their lives submerged at depths greater than 200 m (660 ft), occupying both the epipelagic and mesopelagic zones.[24]

Sunfish are most often found in water warmer than 10 °C (50 °F);[24] prolonged periods spent in water at temperatures of 12 °C (54 °F) or lower can lead to disorientation and eventual death.[20] Researchers theorize that surface basking behaviour, in which a sunfish swims on its side, presenting its largest profile to the sun, may be a method of "thermally recharging" following dives into deeper, colder water.[22][25] Others point to sightings of the fish in colder waters outside of its usual habitat, such as those southwest of England, as evidence of increasing marine temperatures.[26][27]

Sunfish are usually found alone, but occasionally in pairs or in large groups while being cleaned.[11] They swim primarily in open waters, but are sometimes seen near kelp beds taking advantage of resident populations of smaller fish which remove ectoparasites from their skin. Because sunfish must consume a large volume of prey, their presence in a given area may be used as an indicator of nutrient-rich waters where endangered species may be found.[11]

Feeding [edit]

The diet of the ocean sunfish consists primarily of various jellyfish. It also consumes salps, squid, crustaceans, small fish, fish larvae, and eel grass.[1] This range of food items indicates that the sunfish feeds at many levels, from the surface to deep water, and occasionally down to the seafloor in some areas.[1] The diet is nutritionally poor, forcing the sunfish to consume a large amount of food to maintain its size.[20]

Life cycle [edit]

A sunfish fry, which still possesses spines that will later disappear

Ocean sunfish may live up to ten years in captivity, but their lifespan in a natural habitat has not yet been determined.[19] Their growth rate is also undetermined. However, it is known that a young specimen at the Monterey Bay Aquarium increased in weight from 26 to 399 kg (57 to 880 lb) and reached a height of nearly 1.8 m (5.9 ft) in fifteen months.[20]

The sheer size and thick skin of an adult of the species deters many smaller predators, but younger individuals are vulnerable to predation by bluefin tuna and mahi mahi. Adults are consumed by sea lions, orcas and sharks.[11] Sea lions appear to hunt sunfish for sport, tearing the fins off, tossing the body around, and then simply abandoning the still-living but helpless fish to die on the seafloor.[1][20]

The mating practices of the ocean sunfish are poorly understood, but spawning areas have been suggested in the North Atlantic, South Atlantic, North Pacific, South Pacific, and Indian Oceans.[11] Females can produce as many as 300 million eggs at a time, more than any other known vertebrate.[1] Sunfish eggs are released into the water and externally fertilized by sperm.[17]

Newly hatched sunfish larvae are only 2.5 mm (0.098 in) long. They grow to become fry, and those which survive grow many millions of times their original size before reaching adult proportions.[18] Sunfish fry, with large pectoral fins, a tail fin and body spines uncharacteristic of adult sunfish, resemble miniature pufferfish, their close relatives.[17][28] Young sunfish school for protection, but this behaviour is abandoned as they grow.[29]

Human interaction [edit]

Despite their size, ocean sunfish are docile, and pose no threat to human divers.[17] Injuries from sunfish are rare, although there is a slight danger from large sunfish leaping out of the water onto boats; in one instance a boy was knocked off his boat when a sunfish leaped onto it.[30] Areas where they are commonly found are popular destinations for sport dives, and sunfish at some locations have reportedly become familiar with divers.[10] The fish is more of a problem to boaters than to swimmers, as its immense size and weight can cause significant damage to a boat that strikes one of these fish. Collisions with sunfish are very common in some parts of the world and have caused damage to the hull of a boat,[31] and their bodies can become lodged in the propellers of larger ships.[17]

A dish made with the meat of the ocean sunfish

The meat of the ocean sunfish is considered a delicacy in some regions, the largest markets being Taiwan and Japan. All parts of the sunfish are used in cuisine, from the fins to the internal organs.[14] Some parts of the fish are used in some areas of traditional medicine.[10] If the body does contain toxins, then the marketing and sale of ocean sunfish meat is forbidden in the European Union according to Regulation (EC) No 853/2004 of the European Parliament and of the Council.[3]

Sunfish are accidentally but frequently caught in drift gillnet fisheries, making up nearly 30% of the total catch of the swordfish fishery employing drift gillnet in California.[18] The by-catch rate is even higher for the Mediterranean swordfish industry, with 71% to 90% of the total catch being sunfish.[14][29]

The fishery by-catch and destruction of ocean sunfish are unregulated worldwide. In some areas, the fish are "finned" by fishermen who regard them as worthless bait thieves; this process, in which the fins are cut off, results in the eventual death of the fish, because it can no longer propel itself without its dorsal and anal fins.[32] The species is also threatened by floating litter such as plastic bags which resemble jellyfish, its main food. Bags can choke and suffocate an individual or fill its stomach to the extent that it starves.[19]

Many areas of sunfish biology remain poorly understood, and various research efforts are underway, including aerial surveys of mola populations,[33] satellite surveillance using pop-off satellite tags,[14][33] genetic analysis of tissue samples,[14] and collection of amateur sighting data.[34] Recent studies indicate a decrease in sunfish populations that may be caused by more frequent bycatch and the increasing popularity of sunfish in human diet.[11]

Sunfish in captivity [edit]

A tank at the Monterey Bay Aquarium provides a size comparison between an ocean sunfish and humans

Sunfish are not widely held in aquarium exhibits, due to the unique and demanding requirements of their care. Some Asian aquariums display them, particularly in Japan.[20] The Kaiyukan Aquarium in Osaka, Japan, is one of few aquariums with mola on display, where it is reportedly as popular an attraction as the larger whale sharks.[35] The Lisbon Oceanarium in Portugal is another aquarium where sunfish are showcased in the main tank,[36] and in Spain, both the Valencia Oceanogràfic[37] and the Aquarium Barcelona[38] have specimens of sunfish. The Nordsøen Oceanarium in the northern town of Hirtshals in Denmark is also famous for its sunfish.

While it is claimed that the first ocean sunfish to be held in an aquarium in the United States arrived at the Monterey Bay Aquarium in August 1986,[39] other specimens have previously been held at other locations. Marineland of the Pacific, located on the Palos Verdes Peninsula in Los Angeles County, California, held an ocean sunfish in its warm water tank as early as 1957,[40] and in 1964 held a 650-pound specimen, claimed as the largest ever captured at that point in time.[41] However, another 1000-pound specimen was brought alive to Marineland Studios Aquarium, near St. Augustine, Florida, in 1941.[42] As of 2012, Monterey Bay Aquarium is the only location in the United States where the sunfish is displayed.[43] Because sunfish had not been kept in captivity on a large scale before, the staff at Monterey Bay were forced to innovate and create their own methods for capture, feeding, and parasite control. By 1998, these issues were overcome, and the aquarium was able to hold a specimen for more than a year, later releasing it after its weight increased by more than 14 times.[20] Mola mola have since become a permanent feature of the Open Sea exhibit.[18] Monterey Bay Aquarium's largest sunfish specimen was euthanized on February 14, 2008 after an extended period of poor health.[44]

A major concern to curators is preventative measures taken to keep specimens in captivity from injuring themselves by rubbing against the walls of a tank, since ocean sunfish cannot easily maneuver their bodies.[35] In a smaller tank, hanging a vinyl curtain has been used as a stopgap measure to convert a cuboid tank to a rounded shape and prevent the fish from scraping against the sides. A more effective solution is simply to provide enough room for the sunfish to swim in wide circles.[20] The tank must also be sufficiently deep to accommodate the vertical height of the sunfish, which can be nearly as tall as it is long, and may reach a height of 3.2 m (10 ft).[8]

Feeding captive sunfish in a tank with other faster-moving, more aggressive fish can also present a challenge. Eventually, the fish can be taught to respond to a floating target to be fed,[43] and to take food from the end of a pole or from human hands.[20]

References [edit]

  1. ^ a b c d e f g h i j Thys, Tierney. "Molidae Descriptions and Life History". OceanSunfish.org. Retrieved 2007-05-08. 
  2. ^ "Regulation (EC) No 854/2004 of the European Parliament and of the Council of 29 April 2004 laying down specific rules for the organisation of official controls on products of animal origin intended for human consumption". Eur-lex.europa.eu. Retrieved 2010-11-16. 
  3. ^ a b "Regulation (EC) No 853/2004 of the European Parliament and of the Council of 29 April 2004 laying down specific hygiene rules for food of animal origin". Eur-lex.europa.eu. Retrieved 2010-11-16. 
  4. ^ Froese, Rainer, and Daniel Pauly, eds. (2007). Species of Mola in FishBase. June 2007 version.
  5. ^ Parenti, Paolo (September 2003). "Family Molidae Bonaparte 1832: molas or ocean sunfishes" (PDF). Annotated Checklist of Fishes (electronic journal) 18. ISSN 1545-150X. Retrieved 2012-02-06. 
  6. ^ Bass, L. Anna; Heidi Dewar, Tierney Thys, J. Todd. Streelman and Stephen A. Karl (July 2005). "Evolutionary divergence among lineages of the ocean sunfish family, Molidae (Tetraodontiformes)" (PDF). Marine Biology 148 (2): 405–414. doi:10.1007/s00227-005-0089-z. Retrieved 2007-06-26. 
  7. ^ Thys, Tierney. "Molidae information and research (Evolution)". OceanSunfish.org. Retrieved 2007-06-26. 
  8. ^ a b c Juliet Rowan (November 24 2006). "Tropical sunfish visitor as big as a car". The New Zealand Herald. Retrieved 2007-05-08. 
  9. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  10. ^ a b c d e Froese, Rainer and Pauly, Daniel, eds. (2006). "Mola mola" in FishBase. March 2006 version.
  11. ^ a b c d e f g h i j "Mola mola program - Life History". Large Pelagics Research Lab. Archived from the original on 2011-08-19. 
  12. ^ Adam Summers. "No Bones About ’Em". Natural History Magazine. Archived from the original on September 27, 2007. Retrieved 2007-06-30. 
  13. ^ Bone, Quentin; Moore, Richard (2008). Biology of Fishes. Taylor & Francis US. p. 210. ISBN 0203885228. 
  14. ^ a b c d e Thys, Tierney. "Ongoing Research". OceanSunfish.org. Retrieved 2007-06-11. 
  15. ^ "Strange tail of the sunfish". The Natural History Museum. Retrieved 2007-05-11. 
  16. ^ Johnson, G. David; Ralf Britz (October 2005). "Leis' Conundrum: Homology of the Clavus of the Ocean Sunfishes. 2. Ontogeny of the Median Fins and Axial Skeleton of Ranzania laevis (Teleostei, Tetraodontiformes, Molidae)" (PDF (fee required)). Journal of Morphology 266 (1): 11–21. doi:10.1002/jmor.10242. PMID 15549687. Retrieved 2007-06-11. "We thus conclude that the molid clavus is unequivocally formed by modified elements of the dorsal and anal fin and that the caudal fin is lost in molids." 
  17. ^ a b c d e f McGrouther, Mark (2011-04-06). "Ocean Sunfish, Mola mola". Australian Museum Online. Retrieved 2012-02-06. 
  18. ^ a b c d "Ocean sunfish". Monterey Bay Aquarium. Retrieved 2010-11-26. 
  19. ^ a b c d "Mola (Sunfish)". National Geographic. Retrieved 2007-05-08. 
  20. ^ a b c d e f g h i Powell, David C. (2001). "21. Pelagic Fishes". A Fascination for Fish: Adventures of an Underwater Pioneer. Berkeley: University of California Press, Monterey Bay Aquarium. pp. 270–275. ISBN 0-520-22366-7. OCLC 44425533. Retrieved 2007-06-13. 
  21. ^ Thys, Tierney (2007). "Help Unravel the Mystery of the Ocean Sunfish". OceanSunfish.org. Retrieved 2013-05-17. 
  22. ^ a b Thys, Tierney (2003-11-30). "Tracking Ocean Sunfish, Mola mola with Pop-Up Satellite Archival Tags in California Waters". OceanSunfish.org. Retrieved 2007-06-14. 
  23. ^ "Animal Guide: Ocean Sunfish". Monterey Bay Aquarium Animal Guide. Monterey, CA: Monterey Bay Aquarium Foundation. Retrieved October 24, 2010 
  24. ^ a b "Mola mola program - Preliminary results". Large Pelagics Research Lab. January 2006. Archived from the original on 2011-07-20. 
  25. ^ "The Biogeography of Ocean Sunfish (Mola mola)". San Francisco State University Department of Geography. Fall 2000. Retrieved 2008-04-25. 
  26. ^ Oliver, Mark; and agencies (2006-07-25). "Warm Cornish waters attract new marine life". Guardian.co.uk. Retrieved 2007-05-08. 
  27. ^ "Giant sunfish washed up on Overstrand beach in Norfolk". BBC News Online. 2012-12-10. Retrieved 2012-12-10. 
  28. ^ Fishes of the Gulf of Maine. "The Ocean Sunfishes or Headfishes". Fishes of the Gulf of Maine. Retrieved 2007-06-30. 
  29. ^ a b Tierney Thys (February 2003). Swim with giant sunfish in the open ocean (.swf) (Professional conference). Monterey, California, United States: Technology Entertainment Design. Retrieved 2007-05-30. 
  30. ^ "Boy struck by giant tropical fish". BBC. 2005-08-28. Retrieved 2008-04-25. 
  31. ^ Lulham, Amanda (2006-12-23). "Giant sunfish alarm crews". The Daily Telegraph. Retrieved 2007-06-12. 
  32. ^ Thys, Tierney. "Present Fishery/Conservation". Large Pelagics Lab. Archived from the original on 2011-07-20. 
  33. ^ a b "Current Research". Large Pelagics Research Lab. Archived from the original on 2011-07-20. 
  34. ^ "Have you seen a Mola??". Large Pelagics Research Lab. Archived from the original on 2011-09-01. 
  35. ^ a b "Main Creature in Kaiyukan". Osaka Kaiyukan Aquarium. Archived from the original on May 28, 2007. Retrieved 2007-06-13. 
  36. ^ "Ocean sunfish at Oceanario". Oceanario. Retrieved 2009-04-05. 
  37. ^ "Sunfish at Oceanogràfic". Oceanogràfic. Retrieved 2010-08-05. 
  38. ^ Ocean Sunfish L'Aquàrium de Barcelona
  39. ^ "Aquarium Timeline". Monterey Bay Aquarium. Retrieved 2007-06-11. 
  40. ^ Brochure: Marineland of the Pacific, 1957
  41. ^ Los Angeles Times - Jun 15, 1964. p.3
  42. ^ The Miami News, March 16, 1941, p. 5-C
  43. ^ a b Life in the slow lane. Monterey Bay Aquarium. Retrieved October 24, 2010. 
  44. ^ "Aquarium Euthanizes Its Largest Ocean Sunfish". KSBW. Retrieved 2008-12-20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!