Overview

Comprehensive Description

Description

  Common names: cardinalfish (English), cardenal (Espanol)
 
Apogon dovii Günther, 1861


Tailspot cardinalfish,     Onespot cardinalfish



Body oblong, compressed; head large, snout short; eye large; teeth small, no canines, usually present on center and sides of roof of mouth; gill rakers (including rudiments) 5 + 13-14; preopercle serrated, lower membranous flap not extending beyond edge of preoperculum; dorsal rays VI + I, 9; anal rays II, 8; pectoral rays 11-12; tail fin moderately concave; body scales rough; last few scales on tail fin; a row of scales along center of nape; lateral line complete, extends onto base of tail fin; lateral-line scales 23-27.  



Red with large black spot at base of tail fin; a broad dusky stripe on snout and continued behind eye to edge of gill cover; also a narrow dusky stripe sometimes present on front half of lateral line; a pair of silvery-white stripes through eye.


Maximum size to about 10 cm.

Inhabits rock and coral reefs.

Depth 3-45 m.

SE Gulf of California to central Peru, the Revillagigedos, Galapagos and Cocos.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 3 (S) - 45 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Mazatlán, Mexico to Peru.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 10.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 75 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 2272))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 55 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0.5 - 65.5
  Temperature range (°C): 22.344 - 23.233
  Nitrate (umol/L): 4.634 - 6.523
  Salinity (PPS): 34.347 - 34.632
  Oxygen (ml/l): 4.215 - 4.710
  Phosphate (umol/l): 0.643 - 0.824
  Silicate (umol/l): 4.346 - 5.791

Graphical representation

Depth range (m): 0.5 - 65.5

Temperature range (°C): 22.344 - 23.233

Nitrate (umol/L): 4.634 - 6.523

Salinity (PPS): 34.347 - 34.632

Oxygen (ml/l): 4.215 - 4.710

Phosphate (umol/l): 0.643 - 0.824

Silicate (umol/l): 4.346 - 5.791
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 55 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0.5 - 65.5
  Temperature range (°C): 22.344 - 23.233
  Nitrate (umol/L): 4.634 - 6.523
  Salinity (PPS): 34.347 - 34.632
  Oxygen (ml/l): 4.215 - 4.710
  Phosphate (umol/l): 0.643 - 0.824
  Silicate (umol/l): 4.346 - 5.791

Graphical representation

Depth range (m): 0.5 - 65.5

Temperature range (°C): 22.344 - 23.233

Nitrate (umol/L): 4.634 - 6.523

Salinity (PPS): 34.347 - 34.632

Oxygen (ml/l): 4.215 - 4.710

Phosphate (umol/l): 0.643 - 0.824

Silicate (umol/l): 4.346 - 5.791
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Planktivore

Diet: zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Planktivore (Ref. 57615).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Brooded, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apogon dovii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAATGGTGGGGACGGCCCTAAGCCTACTCATTCGAGCCGAGCTAAGCCAGCCCGGAGCCCTTCTTGGCGACGACCAAATTTACAACGTAATTGTTACGGCGCATGCGTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATCCCCCTAATGATTGGAGCCCCCGATATAGCATTCCCTCGAATAAACAATATGAGCTTTTGGCTCCTCCCTCCCTCATTTATTCTACTACTTGCCTCTTCAGGCGTAGAAGCAGGTGCAGGAACCGGATGGACGGTTTACCCCCCTCTTGCAGGAAACCTCGCCCATGCGGGAGCCTCTGTTGATTTAACCATCTTCTCCCTTCACCTGGCGGGTATTTCCTCTATCCTTGGTGCTATTAATTTTATTACTACAATCACTAACATGAAACCCCCAGGAATCACCCAGTATCAAACTCCCCTATTTGTCTGAGCTGTCCTGATCACGGCTGTTCTCCTTCTATTGTCCCTTCCTGTTCTAGCCGCTGGTATCACGATGCTCCTTACAGACCGTAACTTAAATACTACCTTCTTTGACCCTGCAGGAGGTGGAGANCCAATCCTANACNAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apogon dovii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!