Overview
Comprehensive Description
Biology
Found in the sublittoral to upper bathyal zone (Ref. 11230).
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Distribution
Western Pacific: southern Japan. More recent works report its occurrence in Taiwan (Ref. 5193) and Malaysia (Ref. 5756).
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Physical Description
Size
Max. size
30.0 cm SL (male/unsexed; (Ref. 559))
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Ecology
Habitat
Environment
demersal; marine; depth range 90 - 500 m (Ref. 11230)
-
Yamada, U., S. Shirai, T. Irie, M. Tokimura, S. Deng, Y. Zheng, C. Li, Y.U. Kim and Y.S. Kim 1995 Names and illustrations of fishes from the East China Sea and the Yellow Sea. Overseas Fishery Cooperation Foundation, Tokyo, Japan. 288 p. (Ref. 11230)
http://www.fishbase.org/references/FBRefSummary.php?id=11230&speccode=257
Trusted
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 128 - 550
Temperature range (°C): 8.847 - 11.203
Nitrate (umol/L): 16.194 - 20.848
Salinity (PPS): 34.636 - 34.913
Oxygen (ml/l): 4.351 - 4.416
Phosphate (umol/l): 1.227 - 1.497
Silicate (umol/l): 8.791 - 13.313
Graphical representation
Depth range (m): 128 - 550
Temperature range (°C): 8.847 - 11.203
Nitrate (umol/L): 16.194 - 20.848
Salinity (PPS): 34.636 - 34.913
Oxygen (ml/l): 4.351 - 4.416
Phosphate (umol/l): 1.227 - 1.497
Silicate (umol/l): 8.791 - 13.313
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 128 - 550
Temperature range (°C): 8.847 - 11.203
Nitrate (umol/L): 16.194 - 20.848
Salinity (PPS): 34.636 - 34.913
Oxygen (ml/l): 4.351 - 4.416
Phosphate (umol/l): 1.227 - 1.497
Silicate (umol/l): 8.791 - 13.313
Graphical representation
Depth range (m): 128 - 550
Temperature range (°C): 8.847 - 11.203
Nitrate (umol/L): 16.194 - 20.848
Salinity (PPS): 34.636 - 34.913
Oxygen (ml/l): 4.351 - 4.416
Phosphate (umol/l): 1.227 - 1.497
Silicate (umol/l): 8.791 - 13.313
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Found in the sublittoral to upper bathyal zone (Ref. 11230).
-
Masuda, H. and G.R. Allen 1993 Meeresfische der Welt - GroÃ-Indopazifische Region. Tetra Verlag, Herrenteich, Melle. 528 p. (Ref. 9137)
http://www.fishbase.org/references/FBRefSummary.php?id=9137&speccode=127
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Chaunax abei
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTATACCTGGTTTTTGGCGCCTGAGCTGGGATAGTCGGCACAGCTCTAAGCCTACTTATTCGAGCCGAACTAAGCCAACCAGGCTCACTTTTAGGGGAC---GACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATCTTTTTCATAGTGATACCAGTCATGATCGGGGGGTTTGGAAATTGACTTATCCCCCTAATGATCGGGGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTGCCCCCCTCCTTCCTTCTCCTACTCGCTTCCTCCGGGGTCGAAGCCGGAGCCGGCACCGGGTGGACCGTCTACCCCCCGCTATCAGGGAACCTCGCCCATGCAGGAGCATCTGTTGATTTAACAATCTTTTCTCTTCATCTAGCAGGGATCTCATCAATTCTTGGAGCCATTAACTTTATTACAACAATTATTAATATAAAACCCCCAGCTATCTCGCAATATCAGACCCCCCTCTTCGTCTGGGCCGTTTTAATTACCGCCGTCCTTCTTTTGCTCTCCCTACCTGTACTTGCTGCCGGCATCACGATACTTCTCACAGACCGAAACCTAAATACTACATTCTTCGACCCCGCAGGAGGGGGAGACCCGATTCTTTACCAACACCTGTTCTGATTCTTTGGACACCCTGAAGTGTATATTCTAATTCTACCCGGATTTGGAATAGTTTCACATATCGTTGCCTACTACTCCGGCAAAAAAGAACCATTTGGCCACATGGGTATGGTGTGAGCTATAATAGCCATCGGCCTCCTAGGCTTTATTGTGTGGGCACACCACATATTTACAGTTGGAATAGACGTAGATACACGCG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Chaunax abei
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


