Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit shallow sheltered reefs (Ref. 9710). Adults usually with sponges; juveniles openly on sand or reef, mimicking small sponges or nudibranchs (Ref. 48635). Benthic (Ref. 58302). Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Hawaiian and Society islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands and Society Islands, north to Philippines and Midway Atoll, south to Ningaloo Reef (Western Australia), Lord Howe Island, Norfolk
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 12 - 13; Analspines: 0; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits shallow sheltered reefs (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Color variable; has a black phase with white pectoral ray tips. Bony part of illicium with numerous dark crossbands and nearly twice as long as the 2nd dorsal spine; esca an elongate tuft of flattened appendage.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 75 m (Ref. 6773), usually ? - 16 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1.2 - 45
  Temperature range (°C): 26.270 - 29.264
  Nitrate (umol/L): 0.053 - 2.844
  Salinity (PPS): 34.330 - 35.267
  Oxygen (ml/l): 4.238 - 4.549
  Phosphate (umol/l): 0.137 - 0.363
  Silicate (umol/l): 1.094 - 3.808

Graphical representation

Depth range (m): 1.2 - 45

Temperature range (°C): 26.270 - 29.264

Nitrate (umol/L): 0.053 - 2.844

Salinity (PPS): 34.330 - 35.267

Oxygen (ml/l): 4.238 - 4.549

Phosphate (umol/l): 0.137 - 0.363

Silicate (umol/l): 1.094 - 3.808
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 75m.
Recorded at 75 meters.

Habitat: reef-associated. Painted angler.  (Shaw & Nodder, 1794)  Attains 24 cm. Chironectes is a synonym. The head and body is sometimes covered in low wart-like swellings. Colour is variable, often tan, yellow, red, brown or black, body colour solid or with dark ( on light background ) or light ( on dark background ) spots. East Africa S. to Durban, to the Hawaiian and Society Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antennarius pictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTCGGAGCATGGGCTGGCATAGTGGGGACAGCCCTTAGCATTTTAATCCGAGCAGAATTAAGCCAACCGGGCGCACTGTTAGGTGACGATCAGATTTATAATGTCATCGTCACAGCACACGCCTTCGTTATGATTTTTTTTATAGTAATGCCAATTATAATCGGCGGGTTTGGTAACTGACTTATCCCTTTAATAATTGGGGCCCCTGACATAGCATTCCCTCGCATAAATAATATAAGCTTCTGACTTTTACCCCCATCTTTTCTTCTCTTACTAGCTTCATCAGGAGTAGAAGCAGGTGCGGGTACAGGATGAACAGTTTATCCGCCTCTTGCAAGCAACCTAGCCCACGCCGGAGCATCAGTTGATTTAACTATCTTTTCACTTCACCTTGCGGGTGTGTCATCCATTTTAGGGGCTATTAATTTTATTACAACTATTATTAATATAAAACCACTAACCATTTCACAATATCAAACACCACTATTTGTATGAGCCGTGTTGATCACCGCTGTGCTTCTCCTTCTTTCCCTTCCGGTTCTCGCTGCAGGAATTACAATACTATTGACTGACCGAAACCTTAACACAACCTTCTTTGACCCAGCCGGGGGAGGAGACCCTATTCTCTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antennarius pictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Painted frogfish

The painted frogfish or spotted frogfish, Antennarius pictus, is a marine fish belonging to the family Antennariidae.

Description[edit]

The painted frogfish grows up to 30 centimetres (12 in) long. Like other members of its family, it has a globulous, extensible body, with soft skin is covered with small dermal spinules. Its skin is covered partially with few, small, wart-like protuberances, some variably shaped, scab-like blotches and many small eye spots (ocelli) which look like sponges holes. Its large prognathous mouth allows it to consume prey its same size.

The coloring of the body is extremely variable because they always tend to match their living environments. Frogfishes have the capacity to change coloration and pigment pattern in few weeks. However, the dominant coloration goes from white to black, passing through a whole range of related nuances such as cream, pink, yellow, red, and brown, usually with circular eye spots darker than the background color and/or with saddles and blotches. Some specimens can easily be confused with Antennarius maculatus. These characteristics can help to separate the two close species: usually, A. maculatus has red or orange margins on all fins, and sometimes a spike of the saddle blotch starts posterior to the eye, numerous warts on the skin, andfew or no ocellis; A. pictus has also three eye spots on its caudal fin.[1] Juveniles can have a dark background color with small yellow spots.

The first dorsal spine, the [illicium (fish anatomy)|illicium]], is modified and is used as a fishing rod. Its extremity is endowed with a characteristic esca (lure), which looks like a small fish with a pinkish to brownish coloration. The illicium is twice the length of the second dorsal spine and its often darkly banded. The second dorsal spine is practically straight and is mobile, and the third one is bent towards the back of the body; both are membranously attached to the head. They are well separated from each other and from the dorsal fin.[2]

The pectoral fins are angled and help, with the pelvic fins, to move the frogfish on the bottom and to keep a stable position for ambush.

Distribution and habitat[edit]

Antennarius pictus lives in the tropical and subtropical waters from the Indo-Pacific area, Red Sea included.[3] It is found on sheltered rocky and coral reefs, and adults are usually associated with sponges down to 75 m (246 ft) deep, with an average occurrence at 15 m (49 ft).[4]

Feeding[edit]

As all frogfishes, A. hispidus is a voracious carnivore which can attack all all small animals that pass within its "strike range", mainly fishes, but even sometimes congeners. Its prey can be close to its own size.[2]

Behaviour[edit]

Like other members of its family, the painted frogfish has a benthic and solitary lifestyle. They gather during mating period, but do not tolerate each other any more after the act of fertilization. The male can kill or eat the female she it stays close.[2]

References[edit]

  1. ^ "Facts about Clown Frogfish (Antennarius maculatus) - Encyclopedia of Life". Eol.org. 2013-04-25. Retrieved 2013-09-03. 
  2. ^ a b c Pietsch & Grobecker, ‘’Frogfishes of the world’’, Stanford University Press, 1987,ISBN 9780804712637
  3. ^ "Facts about Painted Frogfish (Antennarius pictus) - Encyclopedia of Life". Eol.org. 2009-05-19. Retrieved 2013-09-03. 
  4. ^ "Facts about Painted Frogfish (Antennarius pictus) - Encyclopedia of Life". Eol.org. 2009-05-19. Retrieved 2013-09-03. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!