Overview

Comprehensive Description

Biology

Inhabit sandy, rocky and coral bottoms (Ref. 5521). More common on seaward reefs than on protected reefs. Retreat into recesses when alarmed (Ref. 9710). Nocturnal (Ref. 37108). Secretive, found deep in crevices between branches of live corals (Ref. 26938). Oviparous, with planktonic eggs and larvae (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic along the coast from Florida to Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Bermuda and Florida, USA to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12; Analspines: 4; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

15.0 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body slender, sides compressed. Snout spinules prominent, spine extending into the posterior narial opening. White stripes on upper sides narrow, separated by broader dark bands (Ref. 37108). Body with alternate stripes of red and silvery white; spinous dorsal fin red, white at tips, with a large black spot between the first 3 or 4 spines (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9710), usually ? - 22 m (Ref. 3156)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 0 - 41
  Temperature range (°C): 26.706 - 28.035
  Nitrate (umol/L): 0.161 - 2.722
  Salinity (PPS): 34.217 - 36.594
  Oxygen (ml/l): 4.529 - 4.686
  Phosphate (umol/l): 0.046 - 0.176
  Silicate (umol/l): 1.868 - 3.502

Graphical representation

Depth range (m): 0 - 41

Temperature range (°C): 26.706 - 28.035

Nitrate (umol/L): 0.161 - 2.722

Salinity (PPS): 34.217 - 36.594

Oxygen (ml/l): 4.529 - 4.686

Phosphate (umol/l): 0.046 - 0.176

Silicate (umol/l): 1.868 - 3.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sargocentron coruscum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sargocentron coruscum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTAATTCGAGCTGAACTGAGCCAACCCGGAGCCCTTCTGGGAGACGACCAGATTTATAATGTTATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGNTTCGGGAACTGATTAATTCCTTTAATGATCGGAGCTCCCGACATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTTCCNCCTCCCTCATTCCTACTCCTACTAGCTTCTTCAGGAGTCGAAGCTGGTGCCGGAACAGGCTGAACAGTTTATCCACCCCTTGCAGGCAACTTAGCACACGCAGGGGCTTCTGTTGATCTTACCATTTTCTCACTTCACCTAGCAGGAATTTCCTCAATCCTGGGGGCCATCAACTTTATTACAACTATTATTAATATGAAACCTCCTGCCATTTCTCAATATCAAACACCTCTATTTGTGTGAGCCGTCCTAATTACAGCAGTACTTCTCCTTCTCTCCCTACCAGTACTAGCAGCCGGCATCACAATACTCCTAACAGACCGAAACCTAAACACAACATTCTTTGATCCGGCAGGAGGTGGAGACCCAATTCTTTATCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!