Overview

Comprehensive Description

Biology

Inhabit sandy, rocky and coral bottoms (Ref. 5521). More common on seaward reefs than on protected reefs. Retreat into recesses when alarmed (Ref. 9710). Nocturnal (Ref. 37108). Secretive, found deep in crevices between branches of live corals (Ref. 26938). Oviparous, with planktonic eggs and larvae (Ref. 240).
  • Smith-Vaniz, W.F., B.B. Collette and B.E. Luckhurst 1999 Fishes of Bermuda: history, zoogeography, annotated checklist, and identification keys. American Society of Ichthyologists and Herpetologists Special Publication No. 4. 424 p. (Ref. 35505)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic along the coast from Florida to Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda and Florida, USA to northern South America.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12; Analspines: 4; Analsoft rays: 8
  • Cohen, D.M., A.W. Ebeling, T. Iwamoto, S.B. McDowell, N.B. Marshall, D.E. Rosen, P. Sonoda, W.H. Weed III and L.P. Woods 1973 Fishes of the western North Atlantic. Part six. New Haven, Sears Found. Mar. Res., Yale Univ. (Ref. 37108)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

15.0 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body slender, sides compressed. Snout spinules prominent, spine extending into the posterior narial opening. White stripes on upper sides narrow, separated by broader dark bands (Ref. 37108). Body with alternate stripes of red and silvery white; spinous dorsal fin red, white at tips, with a large black spot between the first 3 or 4 spines (Ref. 13442).
  • Cohen, D.M., A.W. Ebeling, T. Iwamoto, S.B. McDowell, N.B. Marshall, D.E. Rosen, P. Sonoda, W.H. Weed III and L.P. Woods 1973 Fishes of the western North Atlantic. Part six. New Haven, Sears Found. Mar. Res., Yale Univ. (Ref. 37108)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9710), usually ? - 22 m (Ref. 3156)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
  • Wyatt, J.R. 1983 The biology, ecology and bionomics of the squirrelfishes, Holocentridae. p. 50-58. In J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev. 7. (Also appeared in Res. Rpt. Zool. Dept. Univ. West Indies (3):1-41, 1976). (Ref. 3156)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 0 - 41
  Temperature range (°C): 26.706 - 28.035
  Nitrate (umol/L): 0.161 - 2.722
  Salinity (PPS): 34.217 - 36.594
  Oxygen (ml/l): 4.529 - 4.686
  Phosphate (umol/l): 0.046 - 0.176
  Silicate (umol/l): 1.868 - 3.502

Graphical representation

Depth range (m): 0 - 41

Temperature range (°C): 26.706 - 28.035

Nitrate (umol/L): 0.161 - 2.722

Salinity (PPS): 34.217 - 36.594

Oxygen (ml/l): 4.529 - 4.686

Phosphate (umol/l): 0.046 - 0.176

Silicate (umol/l): 1.868 - 3.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron coruscum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTAATTCGAGCTGAACTGAGCCAACCCGGAGCCCTTCTGGGAGACGACCAGATTTATAATGTTATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGNTTCGGGAACTGATTAATTCCTTTAATGATCGGAGCTCCCGACATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTTCCNCCTCCCTCATTCCTACTCCTACTAGCTTCTTCAGGAGTCGAAGCTGGTGCCGGAACAGGCTGAACAGTTTATCCACCCCTTGCAGGCAACTTAGCACACGCAGGGGCTTCTGTTGATCTTACCATTTTCTCACTTCACCTAGCAGGAATTTCCTCAATCCTGGGGGCCATCAACTTTATTACAACTATTATTAATATGAAACCTCCTGCCATTTCTCAATATCAAACACCTCTATTTGTGTGAGCCGTCCTAATTACAGCAGTACTTCTCCTTCTCTCCCTACCAGTACTAGCAGCCGGCATCACAATACTCCTAACAGACCGAAACCTAAACACAACATTCTTTGATCCGGCAGGAGGTGGAGACCCAATTCTTTATCAACACCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron coruscum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!