You are viewing this Species as classified by:

Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Despite its worldwide notoriety, very little is known about the natural ecology and behaviour of this predator. These sharks are usually solitary or occur in pairs, although it is apparently a social animal that can also be found in small aggregations of 10 or more, particularly around a carcass (3) (6). Females are ovoviviparous; the pups hatch from eggs retained within their mother's body, and she then gives birth to live young (10). Great white sharks are particularly slow-growing, late maturing and long-lived, with a small litter size and low reproductive capacity (8). Females do not reproduce until they reach about 4.5 to 5 metres in length, and litter sizes range from two to ten pups (8). The length of gestation is not known but estimated at between 12 and 18 months, and it is likely that these sharks only reproduce every two or three years (8) (11). After birth, there is no maternal care, and despite their large size, survival of young is thought to be low (8). Great whites are at the top of the marine food chain, and these sharks are skilled predators. They feed predominately on fish but will also consume turtles, molluscs, and crustaceans, and are active hunters of small cetaceans such as dolphins and porpoises, and of other marine mammals such as seals and sea lions (12). Using their acute senses of smell, sound location and electroreception, weak and injured prey can be detected from a great distance (7). Efficient swimmers, sharks have a quick turn of speed and will attack rapidly before backing off whilst the prey becomes weakened; they are sometimes seen leaping clear of the water (6). Great whites, unlike most other fish, are able to maintain their body temperature higher than that of the surrounding water using a heat exchange system in their blood vessels (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Great white sharks (Carcharodon carcharias), also known as great white, white pointer, white shark, or white death, are fish, and are in the Lamnidae family of sharks. This family includes the salmon and mako sharks. Lamnidae sharks are warm-blooded (partially endothermic) and intelligent. Great white sharks are one of the most notorious predators.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This mighty shark is often mistakenly thought of as the most voracious predator of the seas, and even has a reputation as a ferocious man-eater, something that sadly has been hugely exaggerated by the media. Their powerful body is supported by a cartilaginous skeleton (as opposed to the bone skeleton of most other vertebrates), is streamlined for efficient movement through the water, and has a pointed snout (5), two large, sickle-shaped pectoral fins and a large triangular first dorsal fin (6). The mouth is armed with an array of sharply pointed, serrated teeth; indeed the generic name is derived from the Greek word carcharos for ragged and odon for tooth (7). These sharks are grey or bronze on the upper surface of the body and are white underneath (5). They have an acute sense of smell and are able to sense electric fields through sensors in the snout (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: shark (English), jaquetón (Espanol), tiburón (Espanol)
 
Carcharodon carcharias (Linnaeus, 1758)


White shark,     Great white shark

Fusiform,  robust body; snout conical, blunt, with nostrils on sides; mouth large, round;  teeth on top jaw triangular, serrated; 5 large gill slits, all before pectoral fin; first dorsal fin large, triangular, origin over rear of base of pectoral fin; second dorsal fin very small; anal fin very small, origin under rear of base of second dorsal fin;  tail almost symmetrical, half-moon shaped; tail base very depressed, with large keel that extends onto tail itself.

Back grey-brown, blue-grey, to blackish; abrupt changing to white/pale grey belly; eye black; underside of tips of fins black, usually a black spot where rear edge of fin joins body.

Size: reaches ~ 600 cm.

Habitat: coastal, inshore to oceanic.

Depth: 0 to 1280 m.

Circumglobal, temperate; in our area: Baja and the Gulf of California; Panama to Chile and the Galapagos and Revillagigedos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Primarily a coastal and offshore inhabitant of continental and insular shelves, but may also occur off oceanic islands far from land (Ref. 247, 43278, 58302). Often close inshore to the surf line and even penetrates shallow bays (Ref. 247). Pelagic, capable of migration across oceanic regions (Ref. 58302). Usually solitary or in pairs but can be found in feeding aggregations of 10 or more; does not form schools (Ref. 247). Feeds on bony fishes, sharks, rays, seals, dolphins and porpoises, sea birds, carrion, squid, octopi and crabs (Ref. 5578) and whales (Ref. 32140). Ovoviviparous, embryos feeding on yolk sac and other ova produced by the mother (Ref. 43278, 50449). Number of young born per litter, 7 (Ref. 31395) to 14 (Ref. 26346). Reported by some experts to attack humans which they mistake for their normal prey (Ref. 47). Most attacks occur in estuaries. Caught by big-game anglers and line boats for its jaws (Ref. 5578). Reported to cause poisoning (Ref. 4690). Flesh is utilized fresh, dried-salted, and smoked for human consumption, the skin for leather, liver for oil, carcass for fishmeal, fins for shark-fin soup, and teeth and jaws for decorations (Ref. 13574). Maximun total length is leading to much speculation and some measurements are found to be doubtful. Possibly to 6.4 m or more in length (Ref. 43278), considered the world's largest predator with a broad prey spectrum. The record of 10.98 m is incorrect (Ref. 13574). Maximum total length for male from Ref. 91029. Sometimes considered the most dangerous shark in the world (Ref. 26938).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description of Carcharodon carcharias

The great white shark, Carcharodon carcharias, is a large shark found in coastal surface waters in all major oceans. Largest individualshave exceeded 6 metres (20 ft) in length, and 2,268 kilograms (5,000 lb) in weight. This shark reaches maturity at around 15 years of age and can have a life span of over 30 years. It is the largest known living macropredatory fish and is one of the primary predators of marine mammals. It also eats a variety of other marine animals including fish, seals, and seabirds. It is the only known surviving species of its genus, Carcharodon, and is ranked first in a list of number of recorded attacks on humans. The IUCN treats the great white shark as vulnerable. As the antihero of Jaws, the great white shark is depicted as a ferocious man eater, they are not indiscriminate eating machines but ambush hunters, taking prey by surprise from below.They live in almost all coastal and offshore waters which have water temperature between 12 and 24 degrees C (54 and 75 degrees F), with greater concentrations in the United States (Atlantic Northeast and California), South Africa, Japan, Australia (especially New South Wales and South Australia), New Zealand, Chile, and the Mediterranean. One of the densest known populations is found around Dyer Island, South Africa where much shark research is conducted. It is an epipelagic fish, observed mostly in the presence of rich game like fur seals, sea lions, small whales, other sharks, sea turtles, and large bony fish species. In the open ocean it has been recorded at depths as great as 1,220 m (4,000 ft) Great whites may migrate considerable distances, from America or South Africa to Australia. Shark attacks most often occur in the morning, within 2 hours after sunrise, when visibility is poor. Although the great white is typically regarded as an apex predator in the wild, it is in rare cases preyed upon by the larger orca (also known as a killer whale).
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The geographic range of great white sharks is extremely wide. From 60°N latitude to 60°S latitude, they can be found in all cold temperate and tropical coastal waters. Great white sharks can be found in coastal waters along central California and off the western cape of South Africa. They have also been reported in North American coastal waters from Newfoundland to Florida and from Alaska to Southern Mexico (MarineBio, 2009). According to National Geographic Society (2009), there are no reliable data on great white shark population numbers.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Great White Shark occupies a cosmopolitan range throughout most seas and oceans with concentrations in temperate coastal seas (Compagno 2001). It is principally known as a pelagic dweller of temperate continental shelf waters, but also ranges into the open ocean far from land and near oceanic islands, the cold boreal and austral (sub-Antarctic) seas and the coastal tropics. It is found from the surfline and the intertidal zone to far offshore, and from the surface down to depths over 250 m. It does not occur in fresh water, but penetrates saline bays and estuaries; during high tide it may swim in bays that have no water at low tide. Recent tagging and tracking studies and DNA analyses have demonstrated that this species undertakes long distance trans-oceanic movements, for example between South Africa and Australasia (Pardini et al. 2001) and California and the Hawaiian Islands (Boustany et al. 2002). Consequently its distribution is not considered disjunct, albeit that interchange between some populations may be limited. It is most commonly recorded from the waters of southern Africa (particularly from Namibia to KwaZulu-Natal and Mozambique); eastern, western and particularly southern Australia; New Zealand; the Japanese archipelago; the north-eastern seaboard of North America, especially Long Island and environs; the Pacific coast of North America, primarily from Oregon to Baja; the coast of Central Chile; and the Mediterranean Sea, primarily the Western-Central region and Tyrrhenian Sea (Compagno 2001).

Great White Sharks also occur, albeit less frequently, at many sites elsewhere (e.g., Brazil, Caribbean, Azores, Hawaii, north-west Africa, east Africa (Kenya, Tanzania), Seychelles, Mauritius, Madagascar, Sri Lanka, northern Australia, New Caledonia and Philippines). Limited inter-hemispherical movement between temperate areas, across equatorial waters by means of tropical submergence has been suspected (Last and Stevens 1994), but more recently Great White Sharks have been found in tropical inshore waters of east and southern Africa and even sighted and photographed by divers on coral reefs in Mozambique and elsewhere (Cliff et al. 2000, Compagno 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmopolitan, mostly amphitemperate. Western Atlantic: Newfoundland, Canada to Argentina; also north Gulf of Mexico, Bahamas, Cuba and Lesser Antilles (Ref. 26938). Eastern Atlantic: France to South Africa, including the Mediterranean. Indian Ocean: Seychelles, South Africa; also Reunion and Mauritius (Ref. 33390). Western Pacific: Siberia to New Zealand and the Marshall Islands; also south Australia (Ref. 26938). Central Pacific: Hawaii. Eastern Pacific: Alaska to Chile. International trade cooperation, Australia (CITES Appendix III, since 28.5.2003; CMS Appendix I and II).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Newfoundland to Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks live in almost all coastal and offshore waters of the world. It was once thought that white sharks were only found in warmer waters with temperatures between 54 and 75 °F (12 and 24 °C), but observations of white sharks in Alaska waters with temperatures approaching freezing indicates they can use sub-arctic and arctic waters too.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nearly circumglobal, mostly in warm temperate seas (including Mediterranean Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Great white sharks are found throughout the world's oceans mostly in temperate and sometimes warm waters but occasionally on cold environments (3). Recent scientific research using satellite tags has found that adults can undertake long return migrations across entire ocean basins and back, while juveniles stay closer to the shore, but can also undertake long-distance coastal migrations (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 1280 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

These massive predators reach lengths of 6 m long and weigh up to 3000 kg (McGouther, 2008). Female great white sharks tend to be larger than male great white sharks, who only reach lengths of approximately 4 m (Compagno, Dando and Fowler, 2005). The massive bodies of great white sharks are streamlined and powerful to generate bursts of speed. Their snouts are narrowed and somewhat pointed, and their eyes are onyx in color. These white bellied sharks have crescent shaped tails with long, nearly-symmetrical upper and lower lobes. The color of the dorsal side varies, dark gray to light gray. Great white sharks have a caudal fin and paired dorsal and pectoral fins that help to propel them through the water. The mouths of great white sharks are 0.9 to 1.2 m wide and the upper and bottom teeth work together when handling prey with the bottom teeth keeping the prey in place while the upper teeth tear into the flesh. Great white sharks are endothermic, generating body heat through metabolism (MarineBio, 2009).

Range mass: 3000 (high) kg.

Range length: 4 to 7 m.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Bass, A.J. 1986 Lamnidae. p. 98-100. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 6581)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 600.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

541 cm TL (male/unsexed; (Ref. 10635)); 594 cm TL (female); max. published weight: 3,230 kg; max. reported age: 36 years (Ref. 31395)
  • Castro, J.I. 2012 A summary of observations on the maximum size attained by the white shark, Carcharodon carcharias. p. 85-90. In M.L Domeier (ed). Global perspectives on the biology and life history of the white shark. CRC Press. 543p.
  • Randall, J.E. 1987 Refutation of lengths of 11.3, 9.0, and 6.4 m attributed to the white shark, Carcharodon carcharias. Calif. Fish and Game 73(3):163-168.
  • Smith, S.W., D.W. Au and C. Show 1998 Intrinsic rebound potential of 26 species of Pacific sharks. Mar. Freshwat. Res. 49:663-678. (Ref. 31395)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 7200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks can reach and likely exceed 21 feet in length (6.4 meters) and weigh 7,330 pounds (3224 kg). The larger great white sharks may occur in colder waters such as the food-rich cold waters of the North Pacific and Arctic Oceans.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum Length 720 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Possibly to 8 m, world's largest predator. Generally in the open ocean, but does swim into shallower waters. Most attacks occurred in estuaries. Usually swims alone or in pairs but can be found in feeding aggregations. A versatile predator with a broad prey spectrum. Feeds on sturgeon and tunas, as well as sea lions and other large animals and fish (Ref. 9987). Presumably ovoviviparous. Reported by some experts to attack humans which they mistake for their normal prey of seals. Reported to cause poisoning (Ref. 4690). Meat is utilized fresh and smoked for human consumption, the skin for leather and the liver for oil (Ref. 9987).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A huge, spindle-shaped shark with conspicuous black eyes, a blunt, conical snout and large, triangular, saw-edged teeth (Ref. 5578). First dorsal-fin origin usually over the pectoral-fin inner margins (Ref. 43278, 6871). Caudal fin crescentic (Ref. 247). Lead-grey to brown or black above, lighter on sides, and abruptly white below (Ref. 6851). Black spot at rear pectoral fin base (Ref. 6851).
  • Bass, A.J. 1986 Lamnidae. p. 98-100. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 6581)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Great white sharks are primarily a coastal and offshore inhabitant of insular and continental shelves (Aidan Martin, 2003). Great white sharks have been known to breach the surface and have also been found at depths of 1,875 meters (Dale, 2008). They seem to prefer waters with sea surface temperatures of 59 to 72°F (Aidan Martin, 2003). They can be found on the following coastlines: California to Alaska, the east coast of the United States, coastal Gulf of Mexico, Hawaii, coasts of South America, South Africa, Australia (except the north coast), New Zealand, Mediterranean Sea, West Africa to Scandinavia, Japan, and the eastern coastline of China to Russia (Dale, 2008).

Range depth: 0 to 1,875m m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The maximum size attained by Great White Sharks remains a matter of debate, and is estimated to be around 6 m, and possibly to 640 cm or more; the largest free-swimming individuals commonly captured are between 500-580 cm (mostly adult females) (Compagno 2001). Lengths at maturity for both sexes remain somewhat undetermined and based on (currently limited) age-growth data it may be possible that different populations mature at varying lengths. The majority of females mature at between 450-500 cm total length (TL) (Francis 1996), but have been reported as immature at sizes as much as 472-490 cm long (Springer 1939, Compagno 2001). Males mature at about 350-410 cm (Pratt 1996, Compagno 2001). One study of age and growth, pooled from 21 specimens (Cailliet et al. 1985) suggests a generalised age of maturity of 10-12 years based on counts of vertebral growth rings that are deposited yearly. A mature female of 500 cm is estimated to have reached c.14-16 years. The average reproductive age is estimated at 17 years. The oldest individual reported is a female with 23 growth rings from South Africa, assumed to be at least 23 years old. Longevity is suspected as being about 30 years (Cailliet et al. 1985). Since 1980, six pregnant females have been verified, taken from coastal waters off Okinawa and Japan (Uchida et al. 1996); North Cape, New Zealand (Francis op. cit.) and Cape Bon, Tunisia (Fergusson 1996). Further recent but unconfirmed reports originated during the same decade from Australia (Bruce 1992, Francis, op. cit. Via J.D. Stevens pers. comm.) and Taiwan (Francis op. cit. As pers. comm. with D. Ebert). Reported litter-sizes range from 2-10 foetuses. Gestation time is unknown but likely to be a year or more (Compagno 2001). Size at birth is within a range of 109-165 cm TL. The Great White Shark is ovoviviparous and practices uterine cannibalism in the form of oophagy (ingestion of unfertilized eggs). Mating has not been reliably witnessed to-date. Conceivably, females may give birth every two or three years rather than annually. Parturition apparently occurs during the spring to late summer in warm-temperate neritic waters.

Great White Sharks take a variety of bony fish as prey, from sedentary demersal rockfish, lingcod and benthic flatfish to fast pelagic species, and ranging in size from small demersal and schooling fishes to giants such as broadbill swordfish and bluefin tuna. Great White Sharks are known to congregate at concentrations of schooling bony fishes such as pilchards and bluefish, and follow the KwaZulu-Natal sardine run off South Africa (Compagno 2001). A broad range of elasmobranchs - sharks and batoids - are eaten by Great White Sharks, as are chimaeroids, chelonians, cephalopods and other molluscs, crustaceans and occasionally sea birds such as cormorants and penguins (Compagno 2001). The role of C. carcharias as a primary predator upon marine mammals and especially pinnipeds (e.g., northern elephant seals, harbour seals, California sealions, fur seals), has dominated much contemporary study of this species due to accessibility and intensive studies of seal colonies and a focus on seal predation as being related to biting of humans by great white sharks. The global importance of pinnipeds as prey taxa may be overstated, due to the regional bias in contemporary field observation towards those areas where sharks and pinnipeds are sympatric. Great White Sharks (especially larger individuals) are also active hunters of small odontocetes, particularly so (but not exclusively) in regions where pinnipeds are scarce or absent. Dead baleen whales and other large cetaceans may contribute a significant amount to the Great White Shark's diet in some areas (Long and Jones 1996), but such food is sporadically available.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in coastal and offshore waters, may enter small bays and harbours and approach shore.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks can be found patrolling nearshore waters as they search for prey and they appear to be regular visitors to the waters of Southeast Alaska, off Yakutat, in Prince William Sound and they have been seen several times in Cook Inlet, along the Alaska Peninsula and in the Aleutian Islands. They likely also use offshore waters much like salmon sharks where they find concentrations of prey.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 1280 m (Ref. 6871), usually 0 - 250 m (Ref. 55270)
  • Florida Museum of Natural History 2005 Biological profiles: kniketooth sawfish. Retrieved on 26 August 2005, from www.flmnh.ufl.edu/fish/Gallery/Descript/KTSawfish/KTSawfish.html. Ichthyology at the Florida Museum of Natural History: Education-Biological Profiles. FLMNH, University of Florida. (Ref. 55270)
  • Last, P.R. and J.D. Stevens 1994 Sharks and rays of Australia. CSIRO, Australia. 513 p. (Ref. 6871)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 516
  Temperature range (°C): 11.444 - 19.831
  Nitrate (umol/L): 1.911 - 3.346
  Salinity (PPS): 33.402 - 35.345
  Oxygen (ml/l): 4.943 - 6.250
  Phosphate (umol/l): 0.477 - 0.495
  Silicate (umol/l): 2.312 - 6.500

Graphical representation

Depth range (m): 0 - 516

Temperature range (°C): 11.444 - 19.831

Nitrate (umol/L): 1.911 - 3.346

Salinity (PPS): 33.402 - 35.345

Oxygen (ml/l): 4.943 - 6.250

Phosphate (umol/l): 0.477 - 0.495

Silicate (umol/l): 2.312 - 6.500
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 1280m.
Recorded at 1280 meters.

Habitat: pelagic. Great white shark.  (Linnaeus, 1758)  A huge, spindle shaped shark with small conspicuous black eyes; a blunt, conical snout and large, triangular, saw-edged teeth. Colour lead-grey to brown or black above, lighter on sides and abruptly white below; black spot at rear pectoral fin base. Attains up to 7,1 metres TL. A swift, active, powerful shark that can leap out of the water. Eats bony fish, sharks, rays, seals, dolphins and porpoises, sea birds, carrion, squid, octopus and crabs. Bears 7 to 9 young. Found in all temperate and tropical seas from the surface down to 1280 metres. A potentially very dangerous species that infrequently attacks swimmers, divers, surfers and boats; frequently investigates divers and boats without attacking. An endangered species that is now being protected in South African waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred habitat is coastal and offshore waters of the continental and insular shelves and offshore continental islands, but recent evidence suggests that adults are probably pelagic for much of the year, readily being found in oceanic waters from the surface to depths of 980 metres and possibly more (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Satellite tags attached to great white shark dorsal fins have revealed that they are highly migratory, just like salmon sharks, and migrate between Baja California and Hawaii, between Australia and South Africa and between South Africa and the Indian Ocean. The migration swimming speeds appear to be steady and the distance covered annually can exceed 12,000 miles (20,000 km). When the Baja-Hawaii white sharks arrive in the Hawaiian Islands their swimming behavior changes to shallower excursions, but the reasons for these migrations and differing behaviors remain a mystery. White sharks were noted using Alaska waters in the 1970s, but as more observations have been compiled they appear to use Alaska waters year round. It is not known how far north in the Bering Sea white sharks travel, but their travels are likely limited only by food availability; if they secure enough food they likely can use even Alaska’s coldest marine waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Young great white sharks typically feed on smaller species such as squid and stingrays, as well as other small sharks (McGrouther, 2008). As these fish mature their appetites change. The diet of adults consists primarily of seals, sealions, dolphins, and whale carcasses (McGrouther, 2008). One of the most frequent prey animals of great white sharks are elephant seals (MarineBio, 2009). Sometimes they feed on turtles and various sea birds (McGrouther, 2008). Great white sharks may attack with different strategies depending on the size of their prey. The most common attack method used by great white sharks involves the shark positioning itself directly below its prey and then swimming vertically into an attack (MarineBio, 2009). These sharks collide into their prey and then bite them. Prey often die from blood loss, decapitation or severance of vital appendages such as fins. Great white sharks have been reported to attack humans but there have been as few as 311 verified deaths from great white shark attacks (Burnie and Wilson, 2001).

Animal Foods: birds; mammals; reptiles; fish; mollusks; other marine invertebrates

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known to feed on mammals (Ref. 247). Anthosoma crassum, Dinemoura latifolia and Pandarus sinuatua (copepods) are known to be parasites of the species (Ref. 5951). Also in Ref. 9137.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks prey upon halibut, salmon, tuna, rays, other sharks, dolphins, porpoises, whales, hair seals, fur seals, elephant seals, sea lions, sea turtles, sea otters, seabirds and invetebrates. As they become adult and get larger, great white sharks take large prey and more marine mammals. Large great white sharks have been observed taking beluga whales in Cook Inlet; they may take walruses in the Bering Sea and Arctic Ocean.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes, sharks/rays, sea snakes/mammals/turtles/birds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Great white sharks are apex predators, meaning they have a large affect on the populations of their prey including elephant seals and sea lions. Great white sharks are hosts to parasites such as copepods (Pandarus sinuatus and Pandarus smithii).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks are apex predators; they are at the top of the food chain. Occasionally great white sharks will encounter a killer whale or another shark of comparable size (Martins and Knickle, 2009). These species pose a small threat to great white sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Great white sharks locate and utilize areas of high food abundance, or “hot spots.” The stomach of a large dead great white shark found beached in Southeast Alaska contained undigested salmon parts, but large great white sharks tend to eat marine mammals because of their higher fat content. Great white shark predation in Alaskan waters may afford some stability to the ecosystem by removing and controlling other large marine predator. Great white shark predation may be limiting the predation by intermediate-sized predators. Great white shark predation on beluga whales in Cook Inlet may be pushing this population of white whales to the brink of extension. The complexities of the predator–prey relationship and their effects on the marine ecosystem are difficult and next-to-impossible to predict and manage.

Only a few great white sharks have been documented to have been killed by people in Alaskan waters and these were caught incidental to catching salmon. Since we know very little about the great white sharks found in Alaska we don’t know if these catches are significant for the population; we don’t even know if the great white shark population in Alaskan waters is seasonal and transitory or stable with sharks plying secretively year around. But their secrecy may be their best strategy for their long-term survival in sub-arctic and arctic waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Sharks have several highly developed senses. Their primary sense is the ability to smell. They can detect a drop of blood in 100 liters of water. They also have the ability to detect electrical charges as small as 0.005 microvolts. Prey can be detected by the electrical field generated by a beating heart or gill action. Fish in hiding can also be detected this way. At feeding aggregations, such as at whale carcasses, this generally solitary species often establishes temporary social hierarchies which are based largely on size. Among similar-sized individuals, the social hierarchy is maintained through a subtle form of body language. Recent research has demonstrated that great whites are socially complex, featuring such behaviors as parallel swimming, jaw gaping, pectoral fin depression, and even splash-fights. Great white sharks are also unusual among sharks in that they sometime rais their heads out of the water, apparently to observe activity above the surface.

Communication Channels: visual ; tactile ; chemical ; electric

Perception Channels: visual ; tactile ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Bony fishes such as salmon, hake, halibut, mackerel and tunas. As well, other sharks, sea turtles, seabirds and marine mammals are eaten.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Observing and measuring social behavior of great white sharks is difficult as they don't allow for easy observation especially in the often cloudy waters off Alaska. Still, evidence is mounting that indicates sharks are socially complex and benefit from these qualities. Feeding hierarchies may be established at locations with abundant prey such as seal and sealion rookeries and floating whale carcasses. An observed attack on beluga whales in Cook Inlet indicates what appeared to be a complex, cooperative attack. This is of special interest because the opaque water reduced or eliminated visual cues during the attack.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

There is not a lot of information about the development of great white sharks. While great white sharks develop in the uterus of the mother shark they eat other embryos and unfertilized eggs (Burnie and Wilson, 2001). When great white sharks are born they are approximately 1 to 1.5 meters in length. Around the age of 10 years, male great white sharks have matured to a length of about 4 meters. Females, on the other hand, mature later, around the age of 15 years, at a length of 4 to 5 meters (MarineBio, 2009).

  • Burnie, D., D. Wilson. 2001. Smithsonian Institution Animal: The Definitive Visual Guide to the World's Wildlife. New York, New York: Dorling Kindersley.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed (Ref. 50449). Up to 10, possibly 14 young born at 120-150 cm (Ref. 26346). Distinct pairing with embrace (Ref. 205). Male and female may swim in parallel while copulating (Ref. 28042, 49562).
  • Gilmore, R.G. 1993 Reproductive biology of lamnoid sharks. Environ. Biol. Fish. 38(1/3):95-114.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The age of great white sharks can be determined by counting the rings that form on the vertebra. It is believed that great white sharks breed between the ages of 9 and 23 years old and that their lifespan is approximately 30 years (Levine, 1998). Various research indicates that great white sharks live somewhere between 30 and 40 years (Shark Information, 2009).

Average lifespan

Status: wild:
30 years.

Average lifespan

Status: wild:
30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks reach maturity around 15 years of age and have a life span of over 30 years. Most fish are aged using bony structures called otoliths; however, sharks do not have bones, making it difficult to age them.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild) Observations: Some estimates suggest these animals may live up to 50 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Much about the mating behavior of great white sharks is still unknown. Some scientists believe that scarred individuals suggest male-male aggression or that a male’s gentle biting of females may precede mating. Bite marks observed on the dorsum, flanks, and particularly the pectoral fins of mature female great whites have been interpreted as the results of mating. It is most likely that the male bites the female during copulation. Great white sharks have also been known to propel two-thirds of their body out of the water and land flat against the surface, causing a large splash. This behavior is called a "pattern breach". This behavior might be used to attract a mate during courtship. Mating has yet to be fully documented in great white sharks, but it is assumed to be similar to internal fertilization in most sharks, where the male inserts his claspers into the cloaca of the female. Courtship behavior, if there is any, is unknown.

Mating System: polygynandrous (promiscuous)

Reproduction is ovoviviparous, that is, fertilized eggs are retained within the body and develop there. Prior to birth, the young in the womb may feed on undeveloped eggs and possibly their unborn siblings. Litters consist of 2 to 10 pups. Newborns are more than 1 meter (about 3 feet) in length. Gestation is thought to take about 12 months, and females are assumed to give birth in warm temperate and subtropical waters, but specific nursery areas are unknown. Females give birth to live young, unlike many other sharks who lay eggs. It is possible that individual females only reproduce biannually, mating soon after giving birth, but this remains to be confirmed. Male great white sharks reach sexual maturity at 3.5 to 4 meters (about 11.5 to 13 feet) in length and about 10 years of age, whereas females reach sexual maturity at 4.5 to 5 meters (about 15 to 16 feet) in length and 12 to 18 years of age.

Breeding interval: Female sharks may breed every two years.

Breeding season: The breeding season is unknown.

Range number of offspring: 2 to 14.

Average number of offspring: 7.

Average gestation period: 14 months.

Range age at sexual or reproductive maturity (female): 14 to 16 years.

Range age at sexual or reproductive maturity (male): 9 to 10 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

Newborns get no help from their mothers after birth. As soon as they are born they swim away and are independent. A newborn is about 1.2 m long and grows 25 cm each year, reaching maturity at 10 years (Dale, 2008). Offspring are capable predators the moment they are born.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating requires the male shark to secure the female by grabbing her with his mouth and inserting his clasper organs into the female for copulation. Females may have bite marks along their flanks and on their pectoral fins indicating she had recently mated. White shark mating is apparently not a gentle affair, but this may be further evidence that great white sharks have a limited sense of pain.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

COLOR: Like Salmon sharks, great white sharks are dark gray above and the underside is whitish. The shark’s colorations help camouflage it both from above and below. The great white shark’s coloration is an important advantage for this predator; it is camouflage as it searches and attacks unsuspecting prey.

SPEED: Great white sharks can swim at speeds approaching 25 miles per hour (40 km per hour) with burst speeds to 35 miles per hour (56 km per hour).

PREDATORY CHARACTERISTICS: Great white sharks are opportunistic, but, like other predators, individual white sharks likely become proficient at taking a few prey species and other prey species only irregularly. The reason for this is that the techniques for locating and safely securing large and dangerous prey are different for each species preyed upon. For example, an adult white shark that's learned to take seals may have learned to drag the adult seals to the bottom until the prey has drowned after which it is consumed. Larger more dangerous prey such as adult elephant seals are more likely to be struck from behind and allowed to bleed out and die before the shark returns to feed; or, for another individual great white shark, relentless and continued attack may be preferred. A great white shark that is successful with a certain prey species may be less likely to bother learning the necessary skills and techniques needed to diversify its diet. Some great white sharks have learned to scavenge whales killed by orcas. Adult great white sharks tend to prey more on marine mammals than fish, preferring prey with high contents of energy-rich fat.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Nostrils detect minute quantities of blood: great white shark
 

The nostrils of great white sharks can detect minute quantities of blood due to highly sensitive nasal sacs.

   
  "The first of a great white shark's senses to come into play when seeking prey is smell. The nasal sacs in a shark's nostrils can detect minute quantities of blood -- as low as 1 part in 1,000,000,000 -- seeping from an injured animal." (Shuker 2001:40)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Organs detect electrical currents: great white shark
 

The snout of a great white shark detects minute electrical currents produced by prey using electrosensitive organs called ampullae of Lorenzini.

   
  "Even sightless, the shark is nevertheless still being guided toward its victim by its sensory armory -- by now the shark's electrical sense is operating. Beneath the skin in its snout are numerous tiny, electrosensitive organs known as ampullae of Lorenzini, each linked to the outside world by an external pore. They detect the minute electrical fields produced by the shark's victim and permit the shark to home in on its prey, and to aim with devastating accuracy its first but generally lethal bite." (Shuker 2001:40)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharodon carcharias

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATTTTTGGTGCATGAGCAGGAATAGTGGGAACAGCCCTAAGCCTTTTAATCCGTGCCGAGCTGGGTCAACCAGGTTCCCTCCTCGGAGATGACCAGATTTATAATGTTATTGTGACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTAATGCCCATCATAATTGGGGGTTTTGGGAATTGACTAATCCCATTAATAATTGGTGCCCCGGACATAGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTCCTTCCCCCTTCCTTTTTACTACTCCTAGCTTCAGCCGGAGTTGAAGCAGGAGCCGGCACTGGTTGAACAGTCTACCCTCCCCTGGCCGGTAATTTAGCACACGCAGGAGCATCCGTTGACCTGGCTATCTTCTCCCTTCACCTAGCAGGTATTTCCTCAATCTTGGCCTCAATTAACTTTATTACAACTATCATCAATATGAAACCCCCAGCAATCTCCCAATACCAAACACCCCTGTTCGTATGATCCATCTTAGTAACAACCATCCTTCTTCTCCTAGCCCTTCCAGTGCTCGCAGCCGGCATCACAATGTTACTTACTGACCGAAATCTAAACACAACATTCTTTGATCCAGCAGGAGGAGGAGACCCTATTCTCTACCAACATCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carcharodon carcharias

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Great white sharks are rare throughout their range. This, coupled with their low reproductive rates and persecution by humans means that the IUCN considers them vulnerable. Hunting and bycatch in commercial fisheries exerts significant pressure on great white shark populations and newer estimates may suggest that great white sharks should be considered endangered.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd+3cd

Version
3.1

Year Assessed
2009

Assessor/s
Fergusson, I., Compagno, L.J.V. & Marks, M.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

Despite the high profile media attention the Great White Shark (Carcharodon carcharias) receives, relatively little is known about its biology. It appears to be fairly uncommon compared to other widely distributed species, being most frequently reported from South Africa, Australia, California and the northeast United States. World catches of Great White Sharks from all causes are difficult to estimate, though it is known to have a relatively low intrinsic rebound potential (Smith et al. 1998). Threats to the species include targeted commercial and sports fisheries for jaws, fins, game records and for aquarium display; protective beach meshing; media-fanned campaigns to kill Great White Sharks after a biting incident occurs; and degradation of inshore habitats used as pupping and nursery grounds.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Listed, Appendix III
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Under various synonyms (maneater, white death), the Great White Shark has long been a focus for negative media attention, generated by its sometimes lethal interactions with humans. As a consequence of this typically exaggerated threat to human safety and an almost legendary "Big Fish" status, the species is targeted as a source for sports-fishing, commercial drumline trophy-hunting (for jaws, teeth and even entire specimens preserved), sporadic human consumption or merely as the piscine whipping-boy of individuals pandering to shark attack paranoia. All of these activities have greatly increased since the "JAWS" media phenomenon of the mid 1970s, not only to the detriment of C. carcharias but also in encouraging targeting of other, less high-profile species. Nowhere is the Great White Shark abundant and productive enough to sustain long-term directed fisheries; the majority of annual captures worldwide being made incidentally through commercial fisheries operating longlines, setlines, gillnets, trawls, fish-traps and other gear. The Great White Shark is ensnared throughout the water column in nearshore fisheries but, notably, is rarely represented in the elasmobranch bycatch of offshore oceanic pelagic fisheries (unlike Shortfin Mako (Isurus oxyrinchus) and Porbeagle (Lamna nasus)). The Great White Shark is vulnerable to capture trauma and may be killed or has limited survivorship after capture. Great White Sharks are curious and readily approach boats, scavenge from fishermens' nets or longlines and devour hooked fish taken by rod-and-line or swordfish harpoon. This vulnerable propensity often results in either their own accidental entrapment or deliberate killing by commercial fishermen. In certain regions the Great White Shark has traditionally been viewed negatively as manifesting a costly interference to fisheries, although some fishers appreciate it for its role in eating pinnipeds that devour their catches. This species is unquestionably vulnerable to directed exploitation such as sports fisheries, the curio trade, the oriental shark-fin trade and even the public aquarium trade. The overall, long-term impact of these causes of mortality upon regional populations, coupled to those caused through indirect fishery captures or protective beach meshing, is probably detrimental. The removal of even a few individuals apparently has very tangible effect at discrete localities (such as the Farallon Islands, California, based upon observations following the cull of four local sharks in 1984 (Ainley et al. 1985)). Habitat degradation (development, pollution and overfishing) also threatens this species and may largely exclude it from areas, perhaps traditionally utilised for feeding or as nurseries, where it was historically much more abundant. Great White Sharks have been sought as the ultimate species to display in large public oceanaria, but with poor survivorship so far. Directed fishery exploitation of Great White Sharks is primarily undertaken with the aim of trading its teeth and jaws as trophies or curios and its fins for the oriental fin trade. In South Africa offers of US$20,000-$50,000 have been made for great white shark jaws and US$600-$800 for individual teeth. Apart from their size, Great White Shark products in the form of curios and fins are boosted in value because of notoriety. A fin-set from a large great white shark may be valued at over US$1,000. Unfortunately, as with rhino horns and elephant tusks, the high value of Great White Shark products encourages poaching, clandestine trade and flouting of protective laws (Compagno 2001). Comparative data of catch-rates and CPUE are sketchy or lacking for most of the Great White Shark's range, although some figures are available from select regions. Observations of game fishery captures in south-east Australia between 1961-1990 indicate a catch-ratio from 1:22 in the 1960s, declining to 1:38 in the 1970s and 1:651in the 1980s (Pepperell 1992), suggesting a possible decline in abundance. South Australian game-fishing catches from 1980-1990 averaged 1.4 sharks per year and has declined since the 1950s, possibly through a reduction in effort (Bruce 1992). Sydney game fishing catches have ranged from 0-17 between 1950-1980, with no significant trend. Commercial bycatches off Australia are suspected to be the largest cause of mortality to Australian Great White Sharks, although without any data to currently substantiate this claim (J.D. Stevens and B. Bruce pers. comm.).

Recent tagging off South Australia (70-90 animals tagged) has demonstrated a 4-6% recapture rate (Stevens and Bruce pers. Comm.), which may be considered cause for concern. Approximately 40% of 126 Great White Sharks tagged at Dyer Island or Struisbaai, South Africa, between 1992-94 were resighted (Compagno unpubl.). Both the Australian and African research demonstrates at least short-term residency and site-affinity with some pronounced seasonality, coupled to more irregular nomadicity. Off the eastern USA, NMFS statistics from 1965-1983 show a decline from 1:67-1:210 (Casey and Pratt 1985), suggesting a possible decline in abundance. Data from beach meshing programmes in NSW and Queensland show a gradual and irregular decline in CPUE since the 1960s (J.D. Stevens and B. Bruce pers. comm.) whilst trends in KwaZulu-Natal meshing programmes are variable and less clear, but essentially downwards. Other indices of catch-rates are available from: California, between 1960-1985 as 0-14 sharks per year (mean 3.2, Klimley 1985), KwaZulu-Natal, between 1974-1988 as 22-61 sharks per year (Cliff et al. 1989) and the Central Mediterranean Sea (Sicilian Channel), between 1950-1994 as 0-8 sharks per year (mean 2.2, Fergusson unpubl.). We presently have no complete data for Japan, New Zealand or Chile. In other areas, catches are much more nominal and very sporadic (e.g., Brazil, Hawaii).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2cd+3cd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These sharks are sparsely distributed and have slow reproduction rates, factors making the population particularly vulnerable and slow to recover from depleted numbers (2). Although the population size is difficult to assess, evidence suggests that their numbers have declined in several areas by up to 90 percent over the last 40 to 100 years (8) (13). Sharks caught either accidentally as bycatch or deliberately targeted are sold for their flesh, skins, oil and fins for shark-fin soup (8). The teeth and jaws of great whites are particularly valuable; a recently recovered specimen was valued at US$ 50,000 (8). Game fishing has increased in popularity recently and the great white is something of a holy grail for enthusiasts due to its great size, powerful resistance to capture, and reputation as the most dangerous fish in the sea (3) (7). Unfortunately, its inquisitive nature and tendency to investigate human activities, as well as to scavenge from fishing gear, makes this shark vulnerable to capture (3). This species is often found close to human settlements and habitat degradation, depletion of prey species, negative attitudes towards the shark, and shark fences to protect bathers further affect population numbers (3) (8). The great white is viewed with fear throughout much of its range, making conservation efforts difficult to initiate, and unwarranted, media-fanned campaigns to kill great whites have even occasionally occurred, following shark attacks or in anticipation of such attacks (3) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Great White Shark is currently protected in the Australian EEZ and state waters, South Africa, Namibia, Israel, Malta and the USA (California and Florida states, with directed fisheries prohibited off all coasts). Protective laws are strict, but loopholes and inadequate enforcement causes problems including promoting the black-market for high-value Great White Shark products including jaws, teeth and fins. Australia has developed a comprehensive and multidisciplinary recovery plan for great white sharks in its waters (Compagno 2001). A proposal to list the great white shark in CITES, to regulate or ban international trade failed in 2000, but Australia has since listed the species in Appendix III. A CITES listing might help slow trade in great white shark products, but will not eliminate low volume criminal trade. The Great White Shark was added to both Appendices of the Convention on the Conservation of Migratory Species (CMS) in 2002 with the objective of providing a framework for the coordination of measures adopted by range states to improve the conservation of the species (Government of Australia 2002). The great white shark should be removed from international game fish record lists, and needs consistently rational and realistic treatment by entertainment and news media to counter its notoriety and inflated market value.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The great white shark is protected in South Africa, Namibia, Australia, the USA and Malta (8) (13). The recent surge of interest in shark dives and ecotourism, especially in South Africa, southern Australia, and Guadalupe Island, Mexico, may provide a substantial local income and an important method of education (12). With effective legislation and policing, this tourist trade may well be a vital method of saving the species despite the complex issues involved (12). Vital research into this misunderstood fish is being carried out in countries such as Australia, Mexico, New Zealand, South Africa and the USA (8), and the FAO (Food and Agriculture Organisation of the UN) has prepared an International Plan of Action for the Conservation and Management of Sharks (IPOA-SHARKS) (14). Indeed, recent scientific findings that great whites regularly undergo long-distance, trans-boundary movements only highlight the need for international protective measures, with national legislation being no guarantee of survival of the species (8). However, further information gained from ongoing studies into their movements and the specific habitats the sharks utilise will hopefully provide the basis for designing appropriate protection measures to aid the survival of this remarkable shark around the world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Great white sharks can be dangerous to humans partaking in aquatic activities in the ocean such as swimming, diving, surfing, kayaking and canoeing. Great white sharks tend to attack swiftly with a single bite and then retreat. If the bite is minimal, the individual may have a chance to seek safety. However, if the bite is critical, damaging large organs or appendages, death can result for the victim. A review of great white shark attacks off the western United States showed that about 7 percent of attacks were fatal, but data from other localities, such as South Africa, show fatality rates of more than 20 percent. Fatality rates as high as 60 percent have been recorded from attacks in the waters off Australia. Many researchers maintain that attacks on humans stem from the shark’s curiosity. Other authorities contend that these attacks may be the result of the shark mistaking humans for its natural prey, such as seals and sea lions. It is also possible that great white sharks intend to attack humans where their normal prey may be scarce (Long, 2009).

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humans hunt great white sharks primarily for sport and for body parts. Great white sharks have developed a reputation in the media as being aggressive and ferocious and as a result they have become a highly prized sport fish. A fully intact jaw of a great white shark can be sold for thousands of dollars. Great white sharks are never abundant because they are at the top of their food chain. In areas that contain great white sharks, boaters and dive operators can earn a living from “shark tourism”. This “shark tourism” allows visitors to see great white sharks up close from the safety of a steel cage suspended in the water (Long, 2009). Traded products that come from great white sharks include fins, jaws, teeth and meat, cartilage, and skin for leather. Liver oil is used in medicines, and the carcass can be used for fish-meal and fertilizer.The trade in shark fins is generally on the increase with records from the Food and Agriculture Organization (FAO) of the United Nations indicating that the international fin trade increased significantly between 1980 and 1990. The demand for shark fin escalated further during the 1990s, making it one of the most expensive fishery products. Jaws and teeth are the most valuable great white shark products in trade.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; source of medicine or drug ; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!