Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Despite its worldwide notoriety, very little is known about the natural ecology and behaviour of this predator. These sharks are usually solitary or occur in pairs, although it is apparently a social animal that can also be found in small aggregations of 10 or more, particularly around a carcass (3) (6). Females are ovoviviparous; the pups hatch from eggs retained within their mother's body, and she then gives birth to live young (10). Great white sharks are particularly slow-growing, late maturing and long-lived, with a small litter size and low reproductive capacity (8). Females do not reproduce until they reach about 4.5 to 5 metres in length, and litter sizes range from two to ten pups (8). The length of gestation is not known but estimated at between 12 and 18 months, and it is likely that these sharks only reproduce every two or three years (8) (11). After birth, there is no maternal care, and despite their large size, survival of young is thought to be low (8). Great whites are at the top of the marine food chain, and these sharks are skilled predators. They feed predominately on fish but will also consume turtles, molluscs, and crustaceans, and are active hunters of small cetaceans such as dolphins and porpoises, and of other marine mammals such as seals and sea lions (12). Using their acute senses of smell, sound location and electroreception, weak and injured prey can be detected from a great distance (7). Efficient swimmers, sharks have a quick turn of speed and will attack rapidly before backing off whilst the prey becomes weakened; they are sometimes seen leaping clear of the water (6). Great whites, unlike most other fish, are able to maintain their body temperature higher than that of the surrounding water using a heat exchange system in their blood vessels (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Great white sharks (Carcharodon carcharias), also known as great white, white pointer, white shark, or white death, are fish, and are in the Lamnidae family of sharks. This family includes the salmon and mako sharks. Lamnidae sharks are warm-blooded (partially endothermic) and intelligent. Great white sharks are one of the most notorious predators.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This mighty shark is often mistakenly thought of as the most voracious predator of the seas, and even has a reputation as a ferocious man-eater, something that sadly has been hugely exaggerated by the media. Their powerful body is supported by a cartilaginous skeleton (as opposed to the bone skeleton of most other vertebrates), is streamlined for efficient movement through the water, and has a pointed snout (5), two large, sickle-shaped pectoral fins and a large triangular first dorsal fin (6). The mouth is armed with an array of sharply pointed, serrated teeth; indeed the generic name is derived from the Greek word carcharos for ragged and odon for tooth (7). These sharks are grey or bronze on the upper surface of the body and are white underneath (5). They have an acute sense of smell and are able to sense electric fields through sensors in the snout (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Primarily a coastal and offshore inhabitant of continental and insular shelves, but may also occur off oceanic islands far from land (Ref. 247, 43278, 58302). Often close inshore to the surf line and even penetrates shallow bays (Ref. 247). Pelagic, capable of migration across oceanic regions (Ref. 58302). Usually solitary or in pairs but can be found in feeding aggregations of 10 or more; does not form schools (Ref. 247). Feeds on bony fishes, sharks, rays, seals, dolphins and porpoises, sea birds, carrion, squid, octopi and crabs (Ref. 5578) and whales (Ref. 32140). Ovoviviparous, embryos feeding on yolk sac and other ova produced by the mother (Ref. 43278, 50449). Number of young born per litter, 7 (Ref. 31395) to 14 (Ref. 26346). Reported by some experts to attack humans which they mistake for their normal prey (Ref. 47). Most attacks occur in estuaries. Caught by big-game anglers and line boats for its jaws (Ref. 5578). Reported to cause poisoning (Ref. 4690). Flesh is utilized fresh, dried-salted, and smoked for human consumption, the skin for leather, liver for oil, carcass for fishmeal, fins for shark-fin soup, and teeth and jaws for decorations (Ref. 13574). Maximun total length is leading to much speculation and some measurements are found to be doubtful. Possibly to 6.4 m or more in length (Ref. 43278), considered the world's largest predator with a broad prey spectrum. The record of 10.98 m is incorrect (Ref. 13574). Maximum total length for male from Ref. 91029. Sometimes considered the most dangerous shark in the world (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description of Carcharodon carcharias

The great white shark, Carcharodon carcharias, is a large shark found in coastal surface waters in all major oceans. Largest individualshave exceeded 6 metres (20 ft) in length, and 2,268 kilograms (5,000 lb) in weight. This shark reaches maturity at around 15 years of age and can have a life span of over 30 years. It is the largest known living macropredatory fish and is one of the primary predators of marine mammals. It also eats a variety of other marine animals including fish, seals, and seabirds. It is the only known surviving species of its genus, Carcharodon, and is ranked first in a list of number of recorded attacks on humans. The IUCN treats the great white shark as vulnerable. As the antihero of Jaws, the great white shark is depicted as a ferocious man eater, they are not indiscriminate eating machines but ambush hunters, taking prey by surprise from below.They live in almost all coastal and offshore waters which have water temperature between 12 and 24 degrees C (54 and 75 degrees F), with greater concentrations in the United States (Atlantic Northeast and California), South Africa, Japan, Australia (especially New South Wales and South Australia), New Zealand, Chile, and the Mediterranean. One of the densest known populations is found around Dyer Island, South Africa where much shark research is conducted. It is an epipelagic fish, observed mostly in the presence of rich game like fur seals, sea lions, small whales, other sharks, sea turtles, and large bony fish species. In the open ocean it has been recorded at depths as great as 1,220 m (4,000 ft) Great whites may migrate considerable distances, from America or South Africa to Australia. Shark attacks most often occur in the morning, within 2 hours after sunrise, when visibility is poor. Although the great white is typically regarded as an apex predator in the wild, it is in rare cases preyed upon by the larger orca (also known as a killer whale).
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), jaquetón (Espanol), tiburón (Espanol)
 
Carcharodon carcharias (Linnaeus, 1758)


White shark,     Great white shark

Fusiform,  robust body; snout conical, blunt, with nostrils on sides; mouth large, round;  teeth on top jaw triangular, serrated; 5 large gill slits, all before pectoral fin; first dorsal fin large, triangular, origin over rear of base of pectoral fin; second dorsal fin very small; anal fin very small, origin under rear of base of second dorsal fin;  tail almost symmetrical, half-moon shaped; tail base very depressed, with large keel that extends onto tail itself.

Back grey-brown, blue-grey, to blackish; abrupt changing to white/pale grey belly; eye black; underside of tips of fins black, usually a black spot where rear edge of fin joins body.

Size: reaches ~ 600 cm.

Habitat: coastal, inshore to oceanic.

Depth: 0 to 1280 m.

Circumglobal, temperate; in our area: Baja and the Gulf of California; Panama to Chile and the Galapagos and Revillagigedos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Great white sharks live in almost all coastal and offshore waters of the world. It was once thought that white sharks were only found in warmer waters with temperatures between 54 and 75 °F (12 and 24 °C), but observations of white sharks in Alaska waters with temperatures approaching freezing indicates they can use sub-arctic and arctic waters too.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Azores Exclusive Economic Zone, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, Eritrea, Europe, European waters (ERMS scope), FAO fishing area 47, FAO fishing area 51, FAO fishing area 57, FAO fishing area 67, FAO fishing area 71, FAO fishing area 77, FAO fishing area 81, FAO fishing area 87, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Israeli part of the Mediterranean Sea - Eastern Basin, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Reunion, Seychelles, South Africa (country), Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan, mostly amphitemperate. Western Atlantic: Newfoundland, Canada to Argentina; also north Gulf of Mexico, Bahamas, Cuba and Lesser Antilles (Ref. 26938). Eastern Atlantic: France to South Africa, including the Mediterranean. Indian Ocean: Red Sea, Seychelles, South Africa; also Reunion and Mauritius (Ref. 33390). Western Pacific: Siberia to New Zealand and the Marshall Islands; also south Australia (Ref. 26938). Central Pacific: Hawaii. Eastern Pacific: Alaska to Chile. International trade cooperation, Australia (CITES Appendix III, since 28.5.2003; CMS Appendix I and II).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Great White Shark occupies a cosmopolitan range throughout most seas and oceans with concentrations in temperate coastal seas (Compagno 2001). It is principally known as a pelagic dweller of temperate continental shelf waters, but also ranges into the open ocean far from land and near oceanic islands, the cold boreal and austral (sub-Antarctic) seas and the coastal tropics. It is found from the surfline and the intertidal zone to far offshore, and from the surface down to depths over 250 m. It does not occur in fresh water, but penetrates saline bays and estuaries; during high tide it may swim in bays that have no water at low tide. Recent tagging and tracking studies and DNA analyses have demonstrated that this species undertakes long distance trans-oceanic movements, for example between South Africa and Australasia (Pardini et al. 2001) and California and the Hawaiian Islands (Boustany et al. 2002). Consequently its distribution is not considered disjunct, albeit that interchange between some populations may be limited. It is most commonly recorded from the waters of southern Africa (particularly from Namibia to KwaZulu-Natal and Mozambique); eastern, western and particularly southern Australia; New Zealand; the Japanese archipelago; the north-eastern seaboard of North America, especially Long Island and environs; the Pacific coast of North America, primarily from Oregon to Baja; the coast of Central Chile; and the Mediterranean Sea, primarily the Western-Central region and Tyrrhenian Sea (Compagno 2001).

Great White Sharks also occur, albeit less frequently, at many sites elsewhere (e.g., Brazil, Caribbean, Azores, Hawaii, north-west Africa, east Africa (Kenya, Tanzania), Seychelles, Mauritius, Madagascar, Sri Lanka, northern Australia, New Caledonia and Philippines). Limited inter-hemispherical movement between temperate areas, across equatorial waters by means of tropical submergence has been suspected (Last and Stevens 1994), but more recently Great White Sharks have been found in tropical inshore waters of east and southern Africa and even sighted and photographed by divers on coral reefs in Mozambique and elsewhere (Cliff et al. 2000, Compagno 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The geographic range of great white sharks is extremely wide. From 60°N latitude to 60°S latitude, they can be found in all cold temperate and tropical coastal waters. Great white sharks can be found in coastal waters along central California and off the western cape of South Africa. They have also been reported in North American coastal waters from Newfoundland to Florida and from Alaska to Southern Mexico (MarineBio, 2009). According to National Geographic Society (2009), there are no reliable data on great white shark population numbers.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Newfoundland to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nearly circumglobal, mostly in warm temperate seas (including Mediterranean Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Great white sharks are found throughout the world's oceans mostly in temperate and sometimes warm waters but occasionally on cold environments (3). Recent scientific research using satellite tags has found that adults can undertake long return migrations across entire ocean basins and back, while juveniles stay closer to the shore, but can also undertake long-distance coastal migrations (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 1280 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

These massive predators reach lengths of 6 m long and weigh up to 3000 kg (McGouther, 2008). Female great white sharks tend to be larger than male great white sharks, who only reach lengths of approximately 4 m (Compagno, Dando and Fowler, 2005). The massive bodies of great white sharks are streamlined and powerful to generate bursts of speed. Their snouts are narrowed and somewhat pointed, and their eyes are onyx in color. These white bellied sharks have crescent shaped tails with long, nearly-symmetrical upper and lower lobes. The color of the dorsal side varies, dark gray to light gray. Great white sharks have a caudal fin and paired dorsal and pectoral fins that help to propel them through the water. The mouths of great white sharks are 0.9 to 1.2 m wide and the upper and bottom teeth work together when handling prey with the bottom teeth keeping the prey in place while the upper teeth tear into the flesh. Great white sharks are endothermic, generating body heat through metabolism (MarineBio, 2009).

Range mass: 3000 (high) kg.

Range length: 4 to 7 m.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 600.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 7200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

541 cm TL (male/unsexed; (Ref. 10635)); 594.4 cm TL (female); max. published weight: 3,230 kg; max. reported age: 36 years (Ref. 31395)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great white sharks can reach and likely exceed 21 feet in length (6.4 meters) and weigh 7,330 pounds (3224 kg). The larger great white sharks may occur in colder waters such as the food-rich cold waters of the North Pacific and Arctic Oceans.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum Length 720 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A huge, spindle-shaped shark with conspicuous black eyes, a blunt, conical snout and large, triangular, saw-edged teeth (Ref. 5578). First dorsal-fin origin usually over the pectoral-fin inner margins (Ref. 43278, 6871). Caudal fin crescentic (Ref. 247). Lead-grey to brown or black above, lighter on sides, and abruptly white below (Ref. 6851). Black spot at rear pectoral fin base (Ref. 6851).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Possibly to 8 m, world's largest predator. Generally in the open ocean, but does swim into shallower waters. Most attacks occurred in estuaries. Usually swims alone or in pairs but can be found in feeding aggregations. A versatile predator with a broad prey spectrum. Feeds on sturgeon and tunas, as well as sea lions and other large animals and fish (Ref. 9987). Presumably ovoviviparous. Reported by some experts to attack humans which they mistake for their normal prey of seals. Reported to cause poisoning (Ref. 4690). Meat is utilized fresh and smoked for human consumption, the skin for leather and the liver for oil (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Great white sharks can be found patrolling nearshore waters as they search for prey and they appear to be regular visitors to the waters of Southeast Alaska, off Yakutat, in Prince William Sound and they have been seen several times in Cook Inlet, along the Alaska Peninsula and in the Aleutian Islands. They likely also use offshore waters much like salmon sharks where they find concentrations of prey.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 1280 m (Ref. 6871), usually 0 - 250 m (Ref. 55270)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The maximum size attained by Great White Sharks remains a matter of debate, and is estimated to be around 6 m, and possibly to 640 cm or more; the largest free-swimming individuals commonly captured are between 500?580 cm (mostly adult females) (Compagno 2001). Lengths at maturity for both sexes remain somewhat undetermined and based on (currently limited) age-growth data it may be possible that different populations mature at varying lengths. The majority of females mature at between 450?500 cm total length (TL) (Francis 1996), but have been reported as immature at sizes as much as 472?490 cm long (Springer 1939, Compagno 2001). Males mature at about 350?410 cm (Pratt 1996, Compagno 2001). One study of age and growth, pooled from 21 specimens (Cailliet et al. 1985) suggests a generalised age of maturity of 10?12 years based on counts of vertebral growth rings that are deposited yearly. A mature female of 500 cm is estimated to have reached c.14?16 years. The average reproductive age is estimated at 17 years. The oldest individual reported is a female with 23 growth rings from South Africa, assumed to be at least 23 years old. Longevity is suspected as being about 30 years (Cailliet et al. 1985). Since 1980, six pregnant females have been verified, taken from coastal waters off Okinawa and Japan (Uchida et al. 1996); North Cape, New Zealand (Francis op. Cit.) and Cape Bon, Tunisia (Fergusson 1996). Further recent but unconfirmed reports originated during the same decade from Australia (Bruce 1992, Francis, op. Cit. Via J.D. Stevens pers. comm.) and Taiwan (Francis op. Cit. As pers. comm. with D. Ebert). Reported litter-sizes range from 2?10 foetuses. Gestation time is unknown but likely to be a year or more (Compagno 2001). Size at birth is within a range of 109?165 cm TL. The Great White Shark is ovoviviparous and practices uterine cannibalism in the form of oophagy (ingestion of unfertilised eggs). Mating has not been reliably witnessed to-date. Conceivably, females may give birth every two or three years rather than annually. Parturition apparently occurs during the spring to late summer in warm-temperate neritic waters.

Great White Sharks take a variety of bony fish as prey, from sedentary demersal rockfish, lingcod and benthic flatfish to fast pelagic species, and ranging in size from small demersal and schooling fishes to giants such as broadbill swordfish and bluefin tuna. Great White Sharks are known to congregate at concentrations of schooling bony fishes such as pilchards and bluefish, and follow the KwaZulu-Natal sardine run off South Africa (Compagno 2001). A broad range of elasmobranchs ? sharks and batoids ? are eaten by Great White Sharks, as are chimaeroids, chelonians, cephalopods and other molluscs, crustaceans and occasionally sea birds such as cormorants and penguins (Compagno 2001). The role of C. carcharias as a primary predator upon marine mammals and especially pinnipeds (e.g., northern elephant seals, harbour seals, California sealions, fur seals), has dominated much contemporary study of this species due to accessibility and intensive studies of seal colonies and a focus on seal predation as being related to biting of humans by great white sharks. The global importance of pinnipeds as prey taxa may be overstated, due to the regional bias in contemporary field observation towards those areas where sharks and pinnipeds are sympatric. Great White Sharks (especially larger individuals) are also active hunters of small odontocetes, particularly so (but not exclusively) in regions where pinnipeds are scarce or absent. Dead baleen whales and other large cetaceans may contribute a significant amount to the Great White Shark?s diet in some areas (Long and Jones 1996), but such food is sporadically available.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great white sharks are primarily a coastal and offshore inhabitant of insular and continental shelves (Aidan Martin, 2003). Great white sharks have been known to breach the surface and have also been found at depths of 1,875 meters (Dale, 2008). They seem to prefer waters with sea surface temperatures of 59 to 72°F (Aidan Martin, 2003). They can be found on the following coastlines: California to Alaska, the east coast of the United States, coastal Gulf of Mexico, Hawaii, coasts of South America, South Africa, Australia (except the north coast), New Zealand, Mediterranean Sea, West Africa to Scandinavia, Japan, and the eastern coastline of China to Russia (Dale, 2008).

Range depth: 0 to 1,875m m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in coastal and offshore waters, may enter small bays and harbours and approach shore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 516
  Temperature range (°C): 11.444 - 19.831
  Nitrate (umol/L): 1.911 - 3.346
  Salinity (PPS): 33.402 - 35.345
  Oxygen (ml/l): 4.943 - 6.250
  Phosphate (umol/l): 0.477 - 0.495
  Silicate (umol/l): 2.312 - 6.500

Graphical representation

Depth range (m): 0 - 516

Temperature range (°C): 11.444 - 19.831

Nitrate (umol/L): 1.911 - 3.346

Salinity (PPS): 33.402 - 35.345

Oxygen (ml/l): 4.943 - 6.250

Phosphate (umol/l): 0.477 - 0.495

Silicate (umol/l): 2.312 - 6.500
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1280m.
Recorded at 1280 meters.

Habitat: pelagic. Great white shark.  (Linnaeus, 1758)  A huge, spindle shaped shark with small conspicuous black eyes; a blunt, conical snout and large, triangular, saw-edged teeth. Colour lead-grey to brown or black above, lighter on sides and abruptly white below; black spot at rear pectoral fin base. Attains up to 7,1 metres TL. A swift, active, powerful shark that can leap out of the water. Eats bony fish, sharks, rays, seals, dolphins and porpoises, sea birds, carrion, squid, octopus and crabs. Bears 7 to 9 young. Found in all temperate and tropical seas from the surface down to 1280 metres. A potentially very dangerous species that infrequently attacks swimmers, divers, surfers and boats; frequently investigates divers and boats without attacking. An endangered species that is now being protected in South African waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred habitat is coastal and offshore waters of the continental and insular shelves and offshore continental islands, but recent evidence suggests that adults are probably pelagic for much of the year, readily being found in oceanic waters from the surface to depths of 980 metres and possibly more (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Satellite tags attached to great white shark dorsal fins have revealed that they are highly migratory, just like salmon sharks, and migrate between Baja California and Hawaii, between Australia and South Africa and between South Africa and the Indian Ocean. The migration swimming speeds appear to be steady and the distance covered annually can exceed 12,000 miles (20,000 km). When the Baja-Hawaii white sharks arrive in the Hawaiian Islands their swimming behavior changes to shallower excursions, but the reasons for these migrations and differing behaviors remain a mystery. White sharks were noted using Alaska waters in the 1970s, but as more observations have been compiled they appear to use Alaska waters year round. It is not known how far north in the Bering Sea white sharks travel, but their travels are likely limited only by food availability; if they secure enough food they likely can use even Alaska’s coldest marine waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Great white sharks prey upon halibut, salmon, tuna, rays, other sharks, dolphins, porpoises, whales, hair seals, fur seals, elephant seals, sea lions, sea turtles, sea otters, seabirds and invetebrates. As they become adult and get larger, great white sharks take large prey and more marine mammals. Large great white sharks have been observed taking beluga whales in Cook Inlet; they may take walruses in the Bering Sea and Arctic Ocean.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known to feed on mammals (Ref. 247). Anthosoma crassum, Dinemoura latifolia and Pandarus sinuatua (copepods) are known to be parasites of the species (Ref. 5951). Also in Ref. 9137.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Young great white sharks typically feed on smaller species such as squid and stingrays, as well as other small sharks (McGrouther, 2008). As these fish mature their appetites change. The diet of adults consists primarily of seals, sealions, dolphins, and whale carcasses (McGrouther, 2008). One of the most frequent prey animals of great white sharks are elephant seals (MarineBio, 2009). Sometimes they feed on turtles and various sea birds (McGrouther, 2008). Great white sharks may attack with different strategies depending on the size of their prey. The most common attack method used by great white sharks involves the shark positioning itself directly below its prey and then swimming vertically into an attack (MarineBio, 2009). These sharks collide into their prey and then bite them. Prey often die from blood loss, decapitation or severance of vital appendages such as fins. Great white sharks have been reported to attack humans but there have been as few as 311 verified deaths from great white shark attacks (Burnie and Wilson, 2001).

Animal Foods: birds; mammals; reptiles; fish; mollusks; other marine invertebrates

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes, sharks/rays, sea snakes/mammals/turtles/birds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Great white sharks are apex predators, meaning they have a large affect on the populations of their prey including elephant seals and sea lions. Great white sharks are hosts to parasites such as copepods (Pandarus sinuatus and Pandarus smithii).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Great white sharks are apex predators; they are at the top of the food chain. Occasionally great white sharks will encounter a killer whale or another shark of comparable size (Martins and Knickle, 2009). These species pose a small threat to great white sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Great white sharks locate and utilize areas of high food abundance, or “hot spots.” The stomach of a large dead great white shark found beached in Southeast Alaska contained undigested salmon parts, but large great white sharks tend to eat marine mammals because of their higher fat content. Great white shark predation in Alaskan waters may afford some stability to the ecosystem by removing and controlling other large marine predator. Great white shark predation may be limiting the predation by intermediate-sized predators. Great white shark predation on beluga whales in Cook Inlet may be pushing this population of white whales to the brink of extension. The complexities of the predator–prey relationship and their effects on the marine ecosystem are difficult and next-to-impossible to predict and manage.

Only a few great white sharks have been documented to have been killed by people in Alaskan waters and these were caught incidental to catching salmon. Since we know very little about the great white sharks found in Alaska we don’t know if these catches are significant for the population; we don’t even know if the great white shark population in Alaskan waters is seasonal and transitory or stable with sharks plying secretively year around. But their secrecy may be their best strategy for their long-term survival in sub-arctic and arctic waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Observing and measuring social behavior of great white sharks is difficult as they don't allow for easy observation especially in the often cloudy waters off Alaska. Still, evidence is mounting that indicates sharks are socially complex and benefit from these qualities. Feeding hierarchies may be established at locations with abundant prey such as seal and sealion rookeries and floating whale carcasses. An observed attack on beluga whales in Cook Inlet indicates what appeared to be a complex, cooperative attack. This is of special interest because the opaque water reduced or eliminated visual cues during the attack.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Sharks have several highly developed senses. Their primary sense is the ability to smell. They can detect a drop of blood in 100 liters of water. They also have the ability to detect electrical charges as small as 0.005 microvolts. Prey can be detected by the electrical field generated by a beating heart or gill action. Fish in hiding can also be detected this way. At feeding aggregations, such as at whale carcasses, this generally solitary species often establishes temporary social hierarchies which are based largely on size. Among similar-sized individuals, the social hierarchy is maintained through a subtle form of body language. Recent research has demonstrated that great whites are socially complex, featuring such behaviors as parallel swimming, jaw gaping, pectoral fin depression, and even splash-fights. Great white sharks are also unusual among sharks in that they sometime rais their heads out of the water, apparently to observe activity above the surface.

Communication Channels: visual ; tactile ; chemical ; electric

Perception Channels: visual ; tactile ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed (Ref. 50449). Up to 10, possibly 14 young born at 120-150 cm (Ref. 26346). Distinct pairing with embrace (Ref. 205). Male and female may swim in parallel while copulating (Ref. 28042, 49562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

There is not a lot of information about the development of great white sharks. While great white sharks develop in the uterus of the mother shark they eat other embryos and unfertilized eggs (Burnie and Wilson, 2001). When great white sharks are born they are approximately 1 to 1.5 meters in length. Around the age of 10 years, male great white sharks have matured to a length of about 4 meters. Females, on the other hand, mature later, around the age of 15 years, at a length of 4 to 5 meters (MarineBio, 2009).

  • Burnie, D., D. Wilson. 2001. Smithsonian Institution Animal: The Definitive Visual Guide to the World's Wildlife. New York, New York: Dorling Kindersley.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Great white sharks reach maturity around 15 years of age and have a life span of over 30 years. Most fish are aged using bony structures called otoliths; however, sharks do not have bones, making it difficult to age them.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The age of great white sharks can be determined by counting the rings that form on the vertebra. It is believed that great white sharks breed between the ages of 9 and 23 years old and that their lifespan is approximately 30 years (Levine, 1998). Various research indicates that great white sharks live somewhere between 30 and 40 years (Shark Information, 2009).

Average lifespan

Status: wild:
30 years.

Average lifespan

Status: wild:
30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild) Observations: Some estimates suggest these animals may live up to 50 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating requires the male shark to secure the female by grabbing her with his mouth and inserting his clasper organs into the female for copulation. Females may have bite marks along their flanks and on their pectoral fins indicating she had recently mated. White shark mating is apparently not a gentle affair, but this may be further evidence that great white sharks have a limited sense of pain.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Much about the mating behavior of great white sharks is still unknown. Some scientists believe that scarred individuals suggest male-male aggression or that a male’s gentle biting of females may precede mating. Bite marks observed on the dorsum, flanks, and particularly the pectoral fins of mature female great whites have been interpreted as the results of mating. It is most likely that the male bites the female during copulation. Great white sharks have also been known to propel two-thirds of their body out of the water and land flat against the surface, causing a large splash. This behavior is called a "pattern breach". This behavior might be used to attract a mate during courtship. Mating has yet to be fully documented in great white sharks, but it is assumed to be similar to internal fertilization in most sharks, where the male inserts his claspers into the cloaca of the female. Courtship behavior, if there is any, is unknown.

Mating System: polygynandrous (promiscuous)

Reproduction is ovoviviparous, that is, fertilized eggs are retained within the body and develop there. Prior to birth, the young in the womb may feed on undeveloped eggs and possibly their unborn siblings. Litters consist of 2 to 10 pups. Newborns are more than 1 meter (about 3 feet) in length. Gestation is thought to take about 12 months, and females are assumed to give birth in warm temperate and subtropical waters, but specific nursery areas are unknown. Females give birth to live young, unlike many other sharks who lay eggs. It is possible that individual females only reproduce biannually, mating soon after giving birth, but this remains to be confirmed. Male great white sharks reach sexual maturity at 3.5 to 4 meters (about 11.5 to 13 feet) in length and about 10 years of age, whereas females reach sexual maturity at 4.5 to 5 meters (about 15 to 16 feet) in length and 12 to 18 years of age.

Breeding interval: Female sharks may breed every two years.

Breeding season: The breeding season is unknown.

Range number of offspring: 2 to 14.

Average number of offspring: 7.

Average gestation period: 14 months.

Range age at sexual or reproductive maturity (female): 14 to 16 years.

Range age at sexual or reproductive maturity (male): 9 to 10 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

Newborns get no help from their mothers after birth. As soon as they are born they swim away and are independent. A newborn is about 1.2 m long and grows 25 cm each year, reaching maturity at 10 years (Dale, 2008). Offspring are capable predators the moment they are born.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

COLOR: Like Salmon sharks, great white sharks are dark gray above and the underside is whitish. The shark’s colorations help camouflage it both from above and below. The great white shark’s coloration is an important advantage for this predator; it is camouflage as it searches and attacks unsuspecting prey.

SPEED: Great white sharks can swim at speeds approaching 25 miles per hour (40 km per hour) with burst speeds to 35 miles per hour (56 km per hour).

PREDATORY CHARACTERISTICS: Great white sharks are opportunistic, but, like other predators, individual white sharks likely become proficient at taking a few prey species and other prey species only irregularly. The reason for this is that the techniques for locating and safely securing large and dangerous prey are different for each species preyed upon. For example, an adult white shark that's learned to take seals may have learned to drag the adult seals to the bottom until the prey has drowned after which it is consumed. Larger more dangerous prey such as adult elephant seals are more likely to be struck from behind and allowed to bleed out and die before the shark returns to feed; or, for another individual great white shark, relentless and continued attack may be preferred. A great white shark that is successful with a certain prey species may be less likely to bother learning the necessary skills and techniques needed to diversify its diet. Some great white sharks have learned to scavenge whales killed by orcas. Adult great white sharks tend to prey more on marine mammals than fish, preferring prey with high contents of energy-rich fat.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Nostrils detect minute quantities of blood: great white shark
 

The nostrils of great white sharks can detect minute quantities of blood due to highly sensitive nasal sacs.

   
  "The first of a great white shark's senses to come into play when seeking prey is smell. The nasal sacs in a shark's nostrils can detect minute quantities of blood -- as low as 1 part in 1,000,000,000 -- seeping from an injured animal." (Shuker 2001:40)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Organs detect electrical currents: great white shark
 

The snout of a great white shark detects minute electrical currents produced by prey using electrosensitive organs called ampullae of Lorenzini.

   
  "Even sightless, the shark is nevertheless still being guided toward its victim by its sensory armory -- by now the shark's electrical sense is operating. Beneath the skin in its snout are numerous tiny, electrosensitive organs known as ampullae of Lorenzini, each linked to the outside world by an external pore. They detect the minute electrical fields produced by the shark's victim and permit the shark to home in on its prey, and to aim with devastating accuracy its first but generally lethal bite." (Shuker 2001:40)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharodon carcharias

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATTTTTGGTGCATGAGCAGGAATAGTGGGAACAGCCCTAAGCCTTTTAATCCGTGCCGAGCTGGGTCAACCAGGTTCCCTCCTCGGAGATGACCAGATTTATAATGTTATTGTGACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTAATGCCCATCATAATTGGGGGTTTTGGGAATTGACTAATCCCATTAATAATTGGTGCCCCGGACATAGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTCCTTCCCCCTTCCTTTTTACTACTCCTAGCTTCAGCCGGAGTTGAAGCAGGAGCCGGCACTGGTTGAACAGTCTACCCTCCCCTGGCCGGTAATTTAGCACACGCAGGAGCATCCGTTGACCTGGCTATCTTCTCCCTTCACCTAGCAGGTATTTCCTCAATCTTGGCCTCAATTAACTTTATTACAACTATCATCAATATGAAACCCCCAGCAATCTCCCAATACCAAACACCCCTGTTCGTATGATCCATCTTAGTAACAACCATCCTTCTTCTCCTAGCCCTTCCAGTGCTCGCAGCCGGCATCACAATGTTACTTACTGACCGAAATCTAAACACAACATTCTTTGATCCAGCAGGAGGAGGAGACCCTATTCTCTACCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharodon carcharias

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd+3cd

Version
3.1

Year Assessed
2009

Assessor/s
Fergusson, I., Compagno, L.J.V. & Marks, M.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

Despite the high profile media attention the Great White Shark (Carcharodon carcharias) receives, relatively little is known about its biology. It appears to be fairly uncommon compared to other widely distributed species, being most frequently reported from South Africa, Australia, California and the northeast United States. World catches of Great White Sharks from all causes are difficult to estimate, though it is known to have a relatively low intrinsic rebound potential (Smith et al. 1998). Threats to the species include targeted commercial and sports fisheries for jaws, fins, game records and for aquarium display; protective beach meshing; media-fanned campaigns to kill Great White Sharks after a biting incident occurs; and degradation of inshore habitats used as pupping and nursery grounds.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great white sharks are rare throughout their range. This, coupled with their low reproductive rates and persecution by humans means that the IUCN considers them vulnerable. Hunting and bycatch in commercial fisheries exerts significant pressure on great white shark populations and newer estimates may suggest that great white sharks should be considered endangered.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Listed, Appendix III
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2cd+3cd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Under various synonyms (maneater, white death), the Great White Shark has long been a focus for negative media attention, generated by its sometimes lethal interactions with humans. As a consequence of this typically exaggerated threat to human safety and an almost legendary ?Big Fish? status, the species is targeted as a source for sports-fishing, commercial drumline trophy-hunting (for jaws, teeth and even entire specimens preserved), sporadic human consumption or merely as the piscine whipping-boy of individuals pandering to shark attack paranoia. All of these activities have greatly increased since the ?JAWS? media phenomenon of the mid 1970s, not only to the detriment of C. carcharias but also in encouraging targeting of other, less high-profile species. Nowhere is the Great White Shark abundant and productive enough to sustain long-term directed fisheries; the majority of annual captures worldwide being made incidentally through commercial fisheries operating longlines, setlines, gillnets, trawls, fish-traps and other gear. The Great White Shark is ensnared throughout the water column in nearshore fisheries but, notably, is rarely represented in the elasmobranch bycatch of offshore oceanic pelagic fisheries (unlike Shortfin Mako (Isurus oxyrinchus) and Porbeagle (Lamna nasus)). The Great White Shark is vulnerable to capture trauma and may be killed or has limited survivorship after capture. Great White Sharks are curious and readily approach boats, scavenge from fishermens? nets or longlines and devour hooked fish taken by rod-and-line or swordfish harpoon. This vulnerable propensity often results in either their own accidental entrapment or deliberate killing by commercial fishermen. In certain regions the Great White Shark has traditionally been viewed negatively as manifesting a costly interference to fisheries, although some fishers appreciate it for its role in eating pinnipeds that devour their catches. This species is unquestionably vulnerable to directed exploitation such as sports fisheries, the curio trade, the oriental shark-fin trade and even the public aquarium trade. The overall, long-term impact of these causes of mortality upon regional populations, coupled to those caused through indirect fishery captures or protective beach meshing, is probably detrimental. The removal of even a few individuals apparently has very tangible effect at discrete localities (such as the Farallon Islands, California, based upon observations following the cull of four local sharks in 1984 (Ainley et al. 1985)). Habitat degradation (development, pollution and overfishing) also threatens this species and may largely exclude it from areas, perhaps traditionally utilised for feeding or as nurseries, where it was historically much more abundant. Great White Sharks have been sought as the ultimate species to display in large public oceanaria, but with poor survivorship so far. Directed fishery exploitation of Great White Sharks is primarily undertaken with the aim of trading its teeth and jaws as trophies or curios and its fins for the oriental fin trade. In South Africa offers of US$20,000?$50,000 have been made for great white shark jaws and US$600? $800 for individual teeth. Apart from their size, Great White Shark products in the form of curios and fins are boosted in value because of notoriety. A fin-set from a large great white shark may be valued at over US$1,000. Unfortunately, as with rhino horns and elephant tusks, the high value of Great White Shark products encourages poaching, clandestine trade and flouting of protective laws (Compagno 2001). Comparative data of catch-rates and CPUE are sketchy or lacking for most of the Great White Shark?s range, although some figures are available from select regions. Observations of game fishery captures in south-east Australia between 1961?1990 indicate a catch-ratio from 1:22 in the 1960s, declining to 1:38 in the 1970s and 1:651in the 1980s (Pepperell 1992), suggesting a possible decline in abundance. South Australian game-fishing catches from 1980?1990 averaged 1.4 sharks per year and has declined since the 1950s, possibly through a reduction in effort (Bruce 1992). Sydney game fishing catches have ranged from 0?17 between 1950?1980, with no significant trend. Commercial bycatches off Australia are suspected to be the largest cause of mortality to Australian Great White Sharks, although without any data to currently substantiate this claim (J.D. Stevens and B. Bruce pers. comm.).

Recent tagging off South Australia (70?90 animals tagged) has demonstrated a 4?6% recapture rate (Stevens and Bruce pers. Comm.), which may be considered cause for concern. Approximately 40% of 126 Great White Sharks tagged at Dyer Island or Struisbaai, South Africa, between 1992?94 were resighted (Compagno unpubl.). Both the Australian and African research demonstrates at least short-term residency and site-affinity with some pronounced seasonality, coupled to more irregular nomadicity. Off the eastern USA, NMFS statistics from 1965?1983 show a decline from 1:67?1:210 (Casey and Pratt 1985), suggesting a possible decline in abundance. Data from beach meshing programmes in NSW and Queensland show a gradual and irregular decline in CPUE since the 1960s (J.D. Stevens and B. Bruce pers. comm.) whilst trends in KwaZulu-Natal meshing programmes are variable and less clear, but essentially downwards. Other indices of catch-rates are available from: California, between 1960?1985 as 0?14 sharks per year (mean 3.2, Klimley 1985), KwaZulu-Natal, between 1974?1988 as 22?61 sharks per year (Cliff et al. 1989) and the Central Mediterranean Sea (Sicilian Channel), between 1950? 1994 as 0?8 sharks per year (mean 2.2, Fergusson unpubl.). We presently have no complete data for Japan, New Zealand or Chile. In other areas, catches are much more nominal and very sporadic (e.g., Brazil, Hawaii).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These sharks are sparsely distributed and have slow reproduction rates, factors making the population particularly vulnerable and slow to recover from depleted numbers (2). Although the population size is difficult to assess, evidence suggests that their numbers have declined in several areas by up to 90 percent over the last 40 to 100 years (8) (13). Sharks caught either accidentally as bycatch or deliberately targeted are sold for their flesh, skins, oil and fins for shark-fin soup (8). The teeth and jaws of great whites are particularly valuable; a recently recovered specimen was valued at US$ 50,000 (8). Game fishing has increased in popularity recently and the great white is something of a holy grail for enthusiasts due to its great size, powerful resistance to capture, and reputation as the most dangerous fish in the sea (3) (7). Unfortunately, its inquisitive nature and tendency to investigate human activities, as well as to scavenge from fishing gear, makes this shark vulnerable to capture (3). This species is often found close to human settlements and habitat degradation, depletion of prey species, negative attitudes towards the shark, and shark fences to protect bathers further affect population numbers (3) (8). The great white is viewed with fear throughout much of its range, making conservation efforts difficult to initiate, and unwarranted, media-fanned campaigns to kill great whites have even occasionally occurred, following shark attacks or in anticipation of such attacks (3) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Great White Shark is currently protected in the Australian EEZ and state waters, South Africa, Namibia, Israel, Malta and the USA (California and Florida states, with directed fisheries prohibited off all coasts). Protective laws are strict, but loopholes and inadequate enforcement causes problems including promoting the black-market for high-value Great White Shark products including jaws, teeth and fins. Australia has developed a comprehensive and multidisciplinary recovery plan for great white sharks in its waters (Compagno 2001). A proposal to list the great white shark in CITES, to regulate or ban international trade failed in 2000, but Australia has since listed the species in Appendix III. A CITES listing might help slow trade in great white shark products, but will not eliminate low volume criminal trade. The Great White Shark was added to both Appendices of the Convention on the Conservation of Migratory Species (CMS) in 2002 with the objective of providing a framework for the coordination of measures adopted by range states to improve the conservation of the species (Government of Australia 2002). The great white shark should be removed from international game fish record lists, and needs consistently rational and realistic treatment by entertainment and news media to counter its notoriety and inflated market value.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The great white shark is protected in South Africa, Namibia, Australia, the USA and Malta (8) (13). The recent surge of interest in shark dives and ecotourism, especially in South Africa, southern Australia, and Guadalupe Island, Mexico, may provide a substantial local income and an important method of education (12). With effective legislation and policing, this tourist trade may well be a vital method of saving the species despite the complex issues involved (12). Vital research into this misunderstood fish is being carried out in countries such as Australia, Mexico, New Zealand, South Africa and the USA (8), and the FAO (Food and Agriculture Organisation of the UN) has prepared an International Plan of Action for the Conservation and Management of Sharks (IPOA-SHARKS) (14). Indeed, recent scientific findings that great whites regularly undergo long-distance, trans-boundary movements only highlight the need for international protective measures, with national legislation being no guarantee of survival of the species (8). However, further information gained from ongoing studies into their movements and the specific habitats the sharks utilise will hopefully provide the basis for designing appropriate protection measures to aid the survival of this remarkable shark around the world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Great white sharks can be dangerous to humans partaking in aquatic activities in the ocean such as swimming, diving, surfing, kayaking and canoeing. Great white sharks tend to attack swiftly with a single bite and then retreat. If the bite is minimal, the individual may have a chance to seek safety. However, if the bite is critical, damaging large organs or appendages, death can result for the victim. A review of great white shark attacks off the western United States showed that about 7 percent of attacks were fatal, but data from other localities, such as South Africa, show fatality rates of more than 20 percent. Fatality rates as high as 60 percent have been recorded from attacks in the waters off Australia. Many researchers maintain that attacks on humans stem from the shark’s curiosity. Other authorities contend that these attacks may be the result of the shark mistaking humans for its natural prey, such as seals and sea lions. It is also possible that great white sharks intend to attack humans where their normal prey may be scarce (Long, 2009).

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans hunt great white sharks primarily for sport and for body parts. Great white sharks have developed a reputation in the media as being aggressive and ferocious and as a result they have become a highly prized sport fish. A fully intact jaw of a great white shark can be sold for thousands of dollars. Great white sharks are never abundant because they are at the top of their food chain. In areas that contain great white sharks, boaters and dive operators can earn a living from “shark tourism”. This “shark tourism” allows visitors to see great white sharks up close from the safety of a steel cage suspended in the water (Long, 2009). Traded products that come from great white sharks include fins, jaws, teeth and meat, cartilage, and skin for leather. Liver oil is used in medicines, and the carcass can be used for fish-meal and fertilizer.The trade in shark fins is generally on the increase with records from the Food and Agriculture Organization (FAO) of the United Nations indicating that the international fin trade increased significantly between 1980 and 1990. The demand for shark fin escalated further during the 1990s, making it one of the most expensive fishery products. Jaws and teeth are the most valuable great white shark products in trade.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; source of medicine or drug ; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great white shark

The great white shark, Carcharodon carcharias, also known as the great white, white pointer, white shark, or white death, is a species of large lamniform shark which can be found in the coastal surface waters of all the major oceans. The great white shark is mainly known for its size, with the largest individuals known to have approached or exceeded 6 m (20 ft) in length,[3] and 2,268 kg (5,000 lb) in weight.[4] This shark reaches its maturity around 15 years of age and can have a life span of over 30 years.

The great white shark is arguably the world's largest known extant macropredatory fish, and is one of the primary predators of marine mammals. It is also known to prey upon a variety of other marine animals, including fish and seabirds. It is the only known surviving species of its genus Carcharodon, and is ranked first in having the most attacks on humans.[5][6][7] The IUCN list the great white shark as a vulnerable species,[2] while it is included in Appendix II of CITES.[8]

The bestselling novel Jaws by Peter Benchley and the subsequent blockbuster film by Steven Spielberg depicted the great white shark as a "ferocious man eater". In reality, humans are not the preferred prey of the great white shark.[9]

Contents

Taxonomy [edit]

In 1758, Carolus Linnaeus gave the great white shark its first scientific name, Squalus carcharias. Later, Sir Andrew Smith gave it Carcharodon as its generic name in 1833, and also in 1873. The generic name was identified with Linnaeus' specific name and the current scientific name Carcharodon carcharias, was finalised. Carcharodon comes from the Greek words karcharos, which means sharp or jagged, and odous, which means tooth.[10]

A 4-cm-tall fossil C. carcharias tooth from Miocene sediments in the Atacama Desert of Chile

Ancestry and fossil record [edit]

The great white shark came into existence during the mid-Miocene epoch. The earliest known fossils of the great white shark are about 16 million years old.[1] However, the phylogeny of the great white is still in dispute. The original hypothesis for the great white's origins is that it shares a common ancestor with a prehistoric shark, such as the C. megalodon. Similarities among the physical remains and the extreme size of both the great white and C. megalodon led many scientists to believe these sharks were closely related, and the name Carcharodon megalodon was applied to the latter. However, a new hypothesis proposes that the C. megalodon and the great white are distant relatives (albeit sharing the family Lamnidae). The great white is also more closely related to an ancient mako shark, Isurus hastalis, than to the C. megalodon, a theory that seems to be supported with the discovery of a complete set of jaws with 222 teeth and 45 vertebrae of the extinct transitional species Carcharodon hubbelli in 1988 and published on November 14, 2012.[11] In addition, the new hypothesis assigns C. megalodon to the genus Carcharocles, which also comprises the other megatoothed sharks; Otodus obliquus is the ancient representative of the extinct Carcharocles lineage.[12]

Distribution and habitat [edit]

Great white shark off Guadalupe Island, Mexico

Great white sharks live in almost all coastal and offshore waters which have water temperature between 12 and 24 °C (54 and 75 °F), with greater concentrations in the United States (Atlantic Northeast and California), South Africa, Japan, Oceania, Chile, and the Mediterranean.[13] One of the densest known populations is found around Dyer Island, South Africa, where almost all of the shark research is done.

The great white is an epipelagic fish, observed mostly in the presence of rich game, such as fur seals, sea lions, cetaceans, other sharks, and large bony fish species. In the open ocean, it has been recorded at depths as great as 4,000 ft (1,200 m).[14] These findings challenge the traditional notion about the great white as being a coastal species.[14]

According to a recent study, California great whites have migrated to an area between Baja California and Hawaii known as the White Shark Café to spend at least 100 days before migrating back to Baja. On the journey out, they swim slowly and dive down to around 900 m (3,000 ft). After they arrive, they change behavior and do short dives to about 300 m (1,000 ft) for up to ten minutes. Another white shark that was tagged off of the South African coast swam to the southern coast of Australia and back within the year. This refuted traditional theories that white sharks are coastal territorial predators and opens up the possibility of interaction between shark populations that were previously thought to have been discrete. The reasons for their migration and what they do at their destination is still unknown. Possibilities that may support this idea include seasonal feeding or mating.[15] A similar study tracked a great white shark from South Africa swimming to Australia's northwestern coast and back, a journey of 20,000 km (12,000 mi; 11,000 nmi) in under nine months.[16]

Anatomy and appearance [edit]

The great white shark has a robust, large, conical snout. The upper and lower lobes on the tail fin are approximately the same size which is similar to some mackerel sharks.

A great white displays countershading, by having a white underside and a grey dorsal area (sometimes in a brown or blue shade) that gives an overall mottled appearance. The coloration makes it difficult for prey to spot the shark because it breaks up the shark's outline when seen from the side. From above, the darker shade blends with the sea and from below it exposes a minimal silhouette against the sunlight.

Great white sharks, like many other sharks, have rows of serrated teeth behind the main ones, ready to replace any that break off. When the shark bites, it shakes its head side-to-side, helping the teeth saw off large chunks of flesh.[17]

Size [edit]

Great white shark caught off Cuba in 1945 which is allegedly 6.4 m (21 ft) long and weighing about 3,175 kg (7,000 lb).[18]

Male great whites reach maturity at 3.5–4.0 m (11–13 ft) long and females at 4.5–5.0 m (15–16 ft) long. Adults on average are 4–5.2 m (13–17.1 ft) long and have a mass of 680–1,100 kg (1,500–2,400 lb). Females are generally larger than males. The great white shark can reach 6.1 m (20 ft) in length and 1,900 kg (4,200 lb) in weight.[3] The maximum size is subject to debate because some reports are rough estimations or speculations performed under questionable circumstances.[19] Among living cartilaginous fish, only the basking and whale sharks and the manta ray average larger and heavier. These three species are generally docile in disposition and given to passively filter-feeding on very small organisms.[20]

A number of very large great white shark specimens have been recorded.[21] For decades, many ichthyological works, as well as the Guinness Book of World Records, listed two great white sharks as the largest individuals: In the 1870s, a 10.9 m (36 ft) great white captured in southern Australian waters, near Port Fairy, and a 11.3 m (37 ft) shark trapped in a herring weir in New Brunswick, Canada, in the 1930s. Some researchers question these measurements' reliability, noting they were much larger than any other accurately reported sighting. This New Brunswick shark may have been a misidentified basking shark, as the two have similar body shapes. The question of the Port Fairy shark was settled in the 1970s when J. E. Randall examined the shark's jaws and "found that the Port Fairy shark was of the order of 5 m (17 ft) in length and suggested that a mistake had been made in the original record, in 1870, of the shark's length".[22]

According to J. E. Randall, the largest white shark reliably measured was a 6.0 m (19.7 ft) individual reported from Ledge Point, Western Australia in 1987.[22] Another great white specimen of similar size has been verified by the Canadian Shark Research Center: A female caught by David McKendrick of Alberton, Prince Edward Island, in August 1988 in the Gulf of St. Lawrence off Prince Edward Island. This female great white was 6.1 m (20 ft) long.[3] However, there is a report considered reliable by some experts of a larger great white shark specimen from Cuba in 1945. This specimen was 6.4 m (21 ft) long and had a body mass of about 3,324 kg (7,330 lb).[23][24]

Photo of large shark on shore surrounded by people
Great white shark caught off Hualien County, Taiwan, on May 14, 1997: It was reportedly almost 7 m (23 ft) in length with a mass of 2,500 kg (5,500 lb).[21]

Several great white sharks caught in modern times have been estimated to be more than 7 m (23 ft) long,[25] but these claims have received some criticism.[19][25] However, J. E. Randall believed that great white shark may have exceeded 6.1 m (20 ft) in length.[22] A great white shark was captured near Kangaroo Island in Australia on April 1, 1987. This shark was estimated to be more than 7 m (23 ft) long by Peter Resiley,[22][26] and has been designated as KANGA.[25] Another great white shark was caught in Malta by Alfredo Cutajar on April 16, 1987. This shark was also estimated to be around 7.13 m (23.4 ft) long by John Abela and has been designated as MALTA.[25] However, Cappo drew criticism because he used shark size estimation methods proposed by J. E. Randall to suggest that the KANGA specimen was 5.8–6.4 m (19–21 ft) long.[25] In a similar fashion, I. K. Fergusson also used shark size estimation methods proposed by J. E. Randall to suggest that the MALTA specimen was 5.3–5.7 m (17–19 ft) long.[25] However, photographic evidence suggested that these specimens were larger than the size estimations yielded through Randall's methods.[25] Thus, a team of scientists—H. F. Mollet, G. M. Cailliet, A. P. Klimley, D. A. Ebert, A. D. Testi, and L. J. V. Compagno—reviewed the cases of the KANGA and MALTA specimens in 1996 to resolve the dispute by conducting a comprehensive morphometric analysis of the remains of these sharks and re-examination of photographic evidence in an attempt to validate the original size estimations and their findings were consistent with them. The findings indicated that estimations by P. Resiley and J. Abela are reasonable and could not be ruled out.[25]

Great white shark's skeleton

One contender in maximum size is the tiger shark, Galeocerdo cuvier. While tiger sharks which are typically both a few feet smaller and have a leaner, less heavy body structure than white sharks, have been confirmed to reach at least 5.5 metres (18 ft) in the length, an unverified specimen was reported to have measured 7.4 metres (24 ft) in length and weighed 3,110 kilograms (6,900 lb).[20][27] Some other macropredatory sharks such as the Greenland shark, Somniosus microcephalus, and the Pacific sleeper shark, Somniosus pacificus, are also reported to rival these sharks in length (but probably weigh a bit less since they more slender in build than a great white) in exceptional cases.[28][29] The question of maximum weight is complicated by the unresolved question of whether or not to include the shark's stomach contents when weighing the shark. With a single bite a great white can take in up to 14 kg (31 lb) of flesh, and can also consume several hundred kilograms of food.

The largest great white recognized by the International Game Fish Association (IGFA) is one caught by Alf Dean in the south Australian waters in 1959, weighing 1,208 kg (2,660 lb).[19] Several larger great whites caught by anglers have since been verified, but were later disallowed from formal recognition by IGFA monitors for rules violations.

Adaptations [edit]

Photo of shark swimming at water surface
A great white shark swimming

Great white sharks, like all other sharks, have an extra sense given by the Ampullae of Lorenzini which enables them to detect the electromagnetic field emitted by the movement of living animals. Every time a living creature moves, it generates an electrical field and great whites are so sensitive they can detect half a billionth of a volt. Even heart beats emit a very faint electrical pulse. If it is close enough, the shark can detect even that faint electrical pulse. Most fish have a less-developed but similar sense using their body's lateral line.[30]

Great white shark biting into the fish head teaser bait next to a cage in False Bay, South Africa.

To more successfully hunt fast and agile prey such as sea lions, the great white has adapted to maintain a body temperature warmer than the surrounding water. One of these adaptations is a "rete mirabile" (Latin for "wonderful net"). This close web-like structure of veins and arteries, located along each lateral side of the shark, conserves heat by warming the cooler arterial blood with the venous blood that has been warmed by the working muscles. This keeps certain parts of the body (particularly the stomach) at temperatures up to 14 °C (25 °F)[31] above that of the surrounding water, while the heart and gills remain at sea temperature. When conserving energy the core body temperature can drop to match the surroundings. A great white shark's success in raising its core temperature is an example of gigantothermy. Therefore, the great white shark can be considered an endothermic poikilotherm because its body temperature is not constant but is internally regulated.[17]

Bite force [edit]

A 2007 study from the University of New South Wales in Sydney, Australia, used CT scans of a shark's skull and computer models to measure the shark's maximum bite force. The study reveals the forces and behaviors its skull is adapted to handle and resolves competing theories about its feeding behavior.[32] In 2008, a team of scientists led by Stephen Wroe conducted an experiment to determine the great white shark's jaw power and findings indicated that a specimen more than 6.1 m (20 ft) long could exert a bite force of over 18,000 newtons (4,000 lbf).[24]

Ecology and behavior [edit]

Photo of inverted shark at surface
A great white shark turns onto its back while hunting tuna bait

This shark's behavior and social structure is not well understood. In South Africa, white sharks have a dominance hierarchy depending on the size, sex and squatter's rights: Females dominate males, larger sharks dominate smaller sharks, and residents dominate newcomers. When hunting, great whites tend to separate and resolve conflicts with rituals and displays. White sharks rarely resort to combat although some individuals have been found with bite marks that match those of other white sharks. This suggests that when another shark approaches too closely to another great white, they react with a warning bite. Another possibility is that white sharks bite to show their dominance.

The great white shark is one of only a few sharks known to regularly lift its head above the sea surface to gaze at other objects such as prey. This is known as spy-hopping. This behavior has also been seen in at least one group of blacktip reef sharks, but this might be learned from interaction with humans (it is theorized that the shark may also be able to smell better this way because smell travels through air faster than through water). The white sharks are generally very curious animals, display intelligence and may also turn to socializing if the situation demands it. At Seal Island, white sharks have been observed arriving and departing in stable "clans" of two to six individuals on a yearly basis. Whether clan members are related is unknown but they get along peacefully enough. In fact, the social structure of a clan is probably most aptly compared to that of a wolf pack; in that each member has a clearly established rank and each clan has an alpha leader. When members of different clans meet, they establish social rank nonviolently through any of a fascinating variety of interactions.[33]

Diet [edit]

A great white shark scavenging on a whale carcass

Great white sharks are carnivorous and prey upon fish (e.g. tuna, rays,[33] other sharks[33]), cetaceans (i.e., dolphins, porpoises, whales), pinnipeds (e.g. seals, fur seals,[33] and sea lions), sea turtles,[33] sea otters, and seabirds.[34] Great whites have also been known to eat objects that they are unable to digest. Upon approaching a length of nearly 4 metres (13 ft), great white sharks begin to target predominately marine mammals for food.[35] These sharks prefer prey with a high content of energy-rich fat. Shark expert Peter Klimley used a rod-and-reel rig and trolled carcasses of a seal, a pig, and a sheep from his boat in the South Farallons. The sharks attacked all three baits but rejected the sheep carcass.[36]

The great white shark's reputation as a ferocious predator is well-earned, yet they are not (as was once believed) indiscriminate "eating machines". They are ambush hunters, taking prey by surprise from below. Near Seal Island, in South Africa's False Bay, shark attacks most often occur in the morning, within 2 hours after sunrise, when visibility is poor. Their success rate is 55% in the first 2 hours, falling to 40% in late morning after which hunting stops.[33]

Hunting techniques vary by species of the prey. Off Seal Island, the sharks ambush brown fur seals from below at high speeds, hitting the seal mid-body. They go so fast that they can completely leave the water. The peak burst speed of these sharks is largely accepted in the scientific community to be above 40 kilometres per hour (25 mph). However further precision is still speculative.[37] They have also been observed chasing prey after a missed attack. Prey is usually attacked at the surface.[38]

Off California, sharks immobilize northern elephant seals with a large bite to the hindquarters (which is the main source of the seal's mobility) and wait for the seal to bleed to death. This technique is especially used on adult male elephant seals which can be as large or larger than the hunter and are potentially dangerous adversaries. Prey is normally attacked sub-surface. Harbour seals are taken from the surface and dragged down until they stop struggling. They are then eaten near the bottom. California sea lions are ambushed from below and struck mid-body before being dragged and eaten.[39]

White sharks also attack dolphins and porpoises from above, behind or below to avoid being detected by their echolocation. Targeted species include dusky dolphins,[25] Risso's dolphins,[25] bottlenose dolphins,[25][40] Humpback dolphins,[40] harbour porpoises,[25] and Dall's porpoises.[25] Close encounters between dolphins and predatory sharks often result in evasive responses by the dolphins.[40] However, in rare cases, a group of dolphins may chase a single predatory shark away in an act of defense.[40] White shark predation on other species of small cetacean has also been observed. In August 1989, a 1.8 metres (5.9 ft) juvenile male pygmy sperm whale, Kogia breviceps, stranded in central California with a bite mark on its caudal peduncle from a great white shark.[41] In addition, white sharks also attack and prey upon beaked whales.[25][40]

A beachcomber looking at bite marks on a beached whale from a great white shark

Even though the great whites are known to generally avoid conflicts with each other, the phenomenon of cannibalism is not alien to this species. Large individuals may aggressively interact intraspecifically with small individuals. A 3 m (9.8 ft) long great white shark was nearly bitten into two by a reportedly 6 m (20 ft) long great white shark in Stradbroke Island, near Brisbane in Australia.[42]

White sharks also scavenge on whale carcasses. In one such documented incident, white sharks were observed scavenging on a whale carcass alongside tiger sharks.[43]

Reproduction [edit]

Almost nothing is known about reproduction in great whites. Some evidence points to the near-soporific effect of a large feast (such as a whale carcass) possibly inducing mating.[44] Great white sharks also reach sexual maturity at around 15 years of age.[45] Maximum life span is believed to be more than 30 years (see references).

Little is known about the great white shark's behavior in the way of mating habits. Birth has never been observed, but pregnant females have been examined. Great white sharks are ovoviviparous, which means eggs develop and hatch in the uterus and continue to develop until birth.[46] The great white has an 11-month gestation period. The shark pup's powerful jaws begin to develop in the first month. The unborn sharks participate in oophagy, in which they feed on ova produced by the mother. Delivery is in spring and summer.[47]

Breaching behaviour [edit]

A breach is the result of a high speed approach to the surface with the resulting momentum taking the shark partially or completely clear of the water. This is a hunting technique employed by great white sharks whilst hunting seals. This behavior often takes place on cape fur seals at Seal Island in False Bay, South Africa but due to the randomness of the location of a shark's breach, it was very hard to document. It was first photographed by Chris Fallows and Rob Lawrence who developed the technique of towing a slow moving seal decoy to trick the sharks to breach.[48] Here, in the region of 600 natural predatory events are recorded annually from April to September each year. The seals swim on the surface and the great white sharks launch their predatory attack from the deeper water below. They can reach speeds of up to 40 kilometres per hour (25 mph) and can at times launch themselves more than 10 feet (3.0 m) into the air. Data recorded shows that the sharks are successful in just under 50% of all these natural predatory events.[49] In 2011, a 3 metres (9.8 ft) long shark jumped onto a seven-person research vessel off Seal Island in Mossel Bay. The crew were undertaking a population study using sardines as bait, and the incident was judged to be an accident.[50]

Relationship with humans [edit]

Shark attacks [edit]

More than any documented attack, Peter Benchley's best selling novel Jaws and the subsequent 1975 film adaptation directed by Steven Spielberg provided the great white shark with the image of being a "man eater" in the public mind.[51] While great white sharks have killed humans, they typically do not target them: for example, in the Mediterranean Sea there have been 31 confirmed attacks against humans in the last two centuries, most of which were non-fatal. Many of the incidents seemed to be "test-bites". Great white sharks also test-bite buoys, flotsam, and other unfamiliar objects, and they might grab a human or a surfboard to identify what it is.

Photo of open-mouthed shark at surface.
The great white shark is one of only four kinds of sharks that have been involved in a significant number of fatal unprovoked attacks on humans.

Other incidents seem to be cases of mistaken identity, in which a shark ambushes a bather or surfer from below, believing the silhouette is from a seal. Many attacks occur in waters with low visibility or other situations which impair the shark's senses. The species appears to not like the taste of humans, or at least finds the taste unfamiliar. Further research shows that they can tell in one bite whether or not the object is worth attacking. Humans, for the most part, are too bony for their liking. They much prefer a fat, protein-rich seal.[52]

However, some researchers have hypothesized that the reason the proportion of fatalities is low is not because sharks do not like human flesh, but because humans are often able to escape after the first bite. In the 1980s John McCosker, the Chair of Aquatic Biology at California Academy, noted that divers who dove solo and were attacked by great whites were generally at least partially consumed, while divers who followed the buddy system were generally rescued by their buddy. McCosker and Timothy C. Tricas, an author and professor at the University of Hawaii, suggest that a standard pattern for great whites is to make an initial devastating attack and then wait for the prey to weaken before consuming the wounded animal. Humans' ability to move out of reach with the help of others, thus foiling the attack, is unusual for a great white's prey.[53]

Humans are not appropriate prey because the shark's digestion is too slow to cope with a human's high ratio of bone to muscle and fat. Accordingly, in most recorded attacks, great whites broke off contact after the first bite. Fatalities are usually caused by blood loss from the initial bite rather than from critical organ loss or from whole consumption. Since 1990, there have been a total of 139 unprovoked great white shark attacks, 29 fatal.[54]

A shark conservationist, Jimmy Hall, reported and documented his personal encounter with a very large great white shark, nicknamed Schatzi, in December 2005 in waters off Hawaii. This encounter received worldwide attention as it remained entirely peaceful. J. Hall was at first cautious, but later swam with this shark without cage protection and touched it repeatedly while filming it simultaneously.[55]

A group of great white sharks was believed to be responsible for an attack on a swimmer at Muriwai Beach in Auckland, New Zealand in February 2013, though initial reports placed the blame on a bronze whaler.[56][57] It was the first confirmed shark attack fatality in the country since 1976.[58][59]

Attacks on boats [edit]

Great white sharks infrequently attack and sometimes even sink boats. Only five of the 108 authenticated unprovoked shark attacks reported from the Pacific Coast during the 20th century involved kayakers.[60] In a few cases they have attacked boats up to 10 metres (33 ft) in length. They have bumped or knocked people overboard, usually attacking the boat from the stern. In one case in 1936, a large shark leapt completely into the South African fishing boat Lucky Jim, knocking a crewman into the sea. Tricas and McCosker's underwater observations suggest that sharks are attracted to boats due to the electrical fields they generate.[61]

Great white sharks in captivity [edit]

Photo of shark
Great white shark in the Monterey Bay Aquarium in September 2006

Prior to August 1981, no great white shark in captivity lived longer than 11 days. In August 1981, a white shark survived for 16 days at SeaWorld San Diego before being released.[62] The idea of containing a live great white at SeaWorld Orlando was used in the 1983 film Jaws 3-D.

In 1984, shortly before its opening day, the Monterey Bay Aquarium in Monterey, California, housed its first great white shark which had died after 10 days. In July 2003, Monterey researchers captured a small female and kept it in a large netted pen near Malibu for five days. They had the rare success of getting the shark to feed in captivity before its release.[63] Not until September 2004, was the aquarium able to place a great white on long-term exhibit. A young female, which was caught off the coast of Ventura, was kept in the aquarium's massive 3,800,000-litre (1,000,000 US gal) Outer Bay exhibit for 198 days before she was released in March 2005. She was tracked for 30 days after release.[64] On the evening of August 31, 2006, the aquarium introduced a juvenile male caught outside Santa Monica Bay.[65] His first meal as a captive was a large salmon steak on September 8, 2006, and as of that date, he was estimated to be 1.72 metres (68 in) in length and to weigh approximately 47 kilograms (100 lb). He was released on January 16, 2007, after 137 days in captivity.

In addition, Monterey Bay Aquarium housed a third great white, a juvenile male, for 162 days between August 27, 2007, and February 5, 2008. On arrival, he was 1.4 metres (4 ft 7 in) long and weighed 30.6 kilograms (67 lb). He grew to 1.8 metres (5 ft 11 in) and 64 kilograms (140 lb) before release. A juvenile female came to the Outer Bay Exhibit on August 27, 2008. While she did swim well, the shark fed only one time during her stay and was tagged and released on September 7, 2008. Another juvenile female was captured near Malibu on August 12, 2009, introduced to the Outer Bay exhibit on August 26, 2009, and was successfully released into the wild on November 4, 2009.[66] The Monterey Bay Aquarium recently added a 4.58 feet (1.40 m) long male into their redesigned "Open Sea" exhibit on August 31, 2011. The animal was harvested in the waters off of Malibu.

Probably the most famous captive was a 2.4 metres (7.9 ft) female named Sandy, which in August 1980 became the only great white to be housed at the California Academy of Sciences' Steinhart Aquarium in San Francisco, California. She was released because she would not eat and constantly bumped against the walls.[67]

Shark tourism [edit]

Photo of man dropping chum off the side of a boat
Putting chum in the water
A great white shark approaches divers in a cage off Dyer Island, Western Cape, South Africa.
A great white shark approaches a cage

Cage diving is most common at sites where great whites are frequent including the coast of South Africa, the Neptune Islands in South Australia,[68] and Guadalupe Island in Baja California. Cage diving and swimming with sharks is a focus for a booming tourist industry due to its popularity.[69][70] A common practice is to chum the water with pieces of fish to attract the sharks. These practices may make sharks more accustomed to people in their environment and to associate human activity with food; a potentially dangerous situation. By drawing bait on a wire towards the cage, tour operators lure the shark to the cage, possibly striking it, exacerbating this problem. Other operators draw the bait away from the cage, causing the shark to swim past the divers.

At present, hang baits are illegal off Isla Guadalupe and reputable dive operators do not use them. Operators in South Africa and Australia continue to use hang baits and pinniped decoys.[71]

Companies object to being blamed for shark attacks, pointing out that lightning tends to strike humans more often than sharks bite humans.[72] Their position is that further research needs to be done before banning practices such as chumming, which may alter natural behavior.[73] One compromise is to only use chum in areas where whites actively patrol anyway, well away from human leisure areas. Also, responsible dive operators do not feed sharks. Only sharks that are willing to scavenge follow the chum trail and if they find no food at the end then the shark soon swims off and does not associate chum with a meal. It has been suggested that government licensing strategies may help enforce these suggested advisories.[71]

The shark tourist industry has some financial leverage in conserving this animal. A single set of great white jaws can fetch a one-time price of up to £20,000. However, that is a fraction of the tourism value of a live shark, a more sustainable economic activity. For example, the dive industry in Gansbaai, South Africa, consists of six boat operators with each boat guiding 30 people each day. With fees between £50 to £150 per person, a single live shark that visits each boat can create anywhere between £9,000 and £27,000 of revenue daily.[74]

Conservation status [edit]

It is unclear how much of a concurrent increase in fishing for great white sharks has caused the decline of great white shark populations from the 1970s to the present. No accurate population numbers are available, but the great white shark is now considered vulnerable.[2] Sharks taken during the long interval between birth and sexual maturity never reproduce, preventing population recovery.

The IUCN notes that very little is known about the actual status of the great white shark, but as it appears uncommon compared to other widely distributed species, it is considered vulnerable.[2] It is included in Appendix II of CITES,[8] meaning that international trade in the species requires a permit.[75] As of March 2010, it has also been included in Annex I of the CMS Migratory Sharks MoU, which strives for increased international understanding and coordination for the protection of certain migratory sharks.[76]

Fishermen target many sharks for their jaws, teeth, and fins, and as game fish in general. The great white shark, however, is rarely an object of commercial fishing, although its flesh is considered valuable. If casually captured (it happens for example in some tonnare in the Mediterranean), it is misleadingly sold as smooth-hound shark.

As of April 2007, great white sharks were fully protected within 370 kilometres (200 nmi) of New Zealand and additionally from fishing by New Zealand-flagged boats outside this range. The maximum penalty is a $250,000 fine and up to six months in prison.[77] In 2013, great white sharks were added to California's Endangered Species Act. From data collected, the population of great whites in the North Pacific is estimated to be fewer than 340 individuals. Research also reveals these sharks are genetically distinct from other members of their species elsewhere in Africa, Australia, and the east coast of North America, having been isolated from other populations. [78] Australia's population of great whites was revealed in a study published on July 7, 2012 was revealed to be two separate populations separated by the Bass Strait into eastern and western populations, and may require regional protection. [79]

Natural threats [edit]

Although the great white is typically regarded as an apex predator in the wild, it is in rare cases preyed upon by the larger orca (also known as the killer whale). Interspecific competition between the great white shark and the orca is probable in regions where dietary preferences of both species may overlap.[40] An incident was documented on October 4, 1997, in the Farallon Islands off California in the United States. An estimated 4.7–5.3-metre (15–17 ft) female orca immobilized an estimated 3–4-metre (9.8–13 ft) great white shark.[80] The orca held the shark upside down to induce tonic immobility and kept the shark still for fifteen minutes, causing it to suffocate and then proceeded to eat the dead shark's liver.[40][80][81] It is believed that the scent of the slain shark's carcass caused all the great whites in the region to flee, forfeiting an opportunity for a great seasonal feed.[82] Another similar attack apparently occurred there in 2000, but its outcome is not clear.[83] After both attacks, the local population of about 100 great whites vanished.[81][83] Following the 2000 incident, a great white with a satellite tag was found to have immediately submerged to a depth of 500 m (1,600 ft) and swum to Hawaii.[83]

See also [edit]

References [edit]

  1. ^ a b Gottfried M. D., Fordyce R. E. (2001). "An associated specimen of Carcharodon angustidens (Chondrichthyes, Lamnidae) from the Late Oligocene of New Zealand, with comments on Carcharodon interrelationships". Journal of Vertebrate Paleontology 21 (4): 730–739. doi:10.1671/0272-4634(2001)021[0730:AASOCA]2.0.CO;2. ISSN 0272-4634. 
  2. ^ a b c d Fergusson, I., Compagno, L.; Marks, M. (2000). "Carcharodon carcharias in IUCN 2012". IUCN Red List of Threatened Species, Vers. 2009.1. International Union for Conservation of Nature and Natural Resources. Retrieved October 28, 2009.  (Database entry includes justification for why this species is vulnerable)
  3. ^ a b c Viegas, Jennifer. "Largest Great White Shark Don't Outweigh Whales, but They Hold Their Own". Discovery Channel. Retrieved 2010-01-19. 
  4. ^ "Great White Shark". National Geographic. Retrieved 2010-07-24. 
  5. ^ Knickle, Craig. "Florida Museum of Natural History Ichthyology Department". www.flmnh.ufl.edu. Retrieved 2009-07-02. 
  6. ^ "ISAF Statistics on Attacking Species of Shark". Florida Museum of Natural History University of Florida. Retrieved 2008-05-04. 
  7. ^ Daley, Audrey (1994). Shark. Hodder & Stroughton. ISBN 0-340-61654-7.  Unknown parameter |unused_data= ignored (help)
  8. ^ a b UNEP-WCMC (2010). Carcharodon carcharias. UNEP-WCMC Species Database: CITES-Listed Species On the World Wide Web. Retrieved 2010-04-08.
  9. ^ Hile, Jennifer (January 23, 2004). "Great White Shark Attacks: Defanging the Myths". Marine Biology. National Geographic. Retrieved May 2, 2010. 
  10. ^ "The Great White Shark". "The Enviro Facts Project". Archived from the original on 2009-06-13. Retrieved 2007-07-09. 
  11. ^ http://www.sciencedaily.com/releases/2012/11/121114172939.htm
  12. ^ Kevin G. N., Charles N. C., Gregory A. W. (2006). [Archive copy at the Wayback Machine Tracing the ancestry of the great white shark] (PDF). Retrieved 2007-12-25. 
  13. ^ "Areal Distribution of the White Shark". National Capital Freenet. Retrieved 2010-10-16. 
  14. ^ a b Thomas, Pete (April 5, 2010). "Great white shark amazes scientists with 4000-foot dive into abyss". GrindTV. 
  15. ^ Thomas, Pete (2006-09-29). "The Great White Way". "Los Angeles Times". Retrieved 2006-10-01. 
  16. ^ "South Africa – Australia – South Africa". "White Shark Trust". 
  17. ^ a b "Great White Sharks, Carcharodon carcharias at MarineBio.org". Marin Bio. Retrieved 20 August 2012. 
  18. ^ Echenique, E. J. "A Shark to Remember: The Story of a Great White Caught in 1945". Archived from the original on 2012-04-27. Retrieved 2013-01-22.  Home Page of Henry F. Mollet, Research Affiliate, Moss Landing Marine Laboratories.
  19. ^ a b c Ellis, Richard and John E. McCosker. 1995. Great White Shark. Stanford University Press, ISBN 0-8047-2529-2
  20. ^ a b Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  21. ^ a b Mollet, H. F. 2008. White Shark Summary Carcharodon carcharias (Linnaeus, 1758). Home Page of Henry F. Mollet, Research Affiliate, Moss Landing Marine Laboratories.
  22. ^ a b c d "Size and age of the white pointer shark, Carcharodon carcharias (Linnaeus)". Retrieved 2006-09-27. 
  23. ^ Tricas, T. C.; McCosker, J. E. (1984-07-12). "Predatory behaviour of the white shark (Carcharodon carcharias), with notes on its biology". Proceedings of the California Academy of Sciences (California Academy of Sciences) 43 (14): 221–238. Retrieved 2013-01-22. 
  24. ^ a b Wroe, S.; Huber, D. R. ; Lowry, M. ; McHenry, C. ; Moreno, K. ; Clausen, P. ; Ferrara, T. L. ; Cunningham, E. ; Dean, M. N. ; Summers, A. P. (2008). "Three-dimensional computer analysis of white shark jaw mechanics: how hard can a great white bite?". Journal of Zoology 276 (4): 336–342. doi:10.1111/j.1469-7998.2008.00494.x. 
  25. ^ a b c d e f g h i j k l m n Klimley, Peter; Ainley, David (1996). Great White Sharks: The Biology of Carcharodon carcharias. Academic Press. pp. 91–108. ISBN 0-12-415031-4. 
  26. ^ "Huge 'White Pointer' Encounter". Retrieved 2010-01-20. 
  27. ^ "Summary of Large Tiger Sharks Galeocerdo cuvier (Peron & LeSueur, 1822)". Retrieved May 3, 2010. 
  28. ^ Eagle, Dane. "Greenland Shark". Florida Museum of Natural History. Retrieved 1 September 2012. 
  29. ^ Martin, R. Aidan. "Pacific Sleeper Shark". ReefQuest Centre for Shark Research. Biology of Sharks and Rays. Retrieved 1 September 2012. 
  30. ^ "The physiology of the ampullae of Lorenzini in sharks". Biology Dept., Davidson College. Biology @ Davidson. Retrieved 20 August 2012. 
  31. ^ Martin, R. Aidan. "Body Temperature of the Great white and Other Lamnoid Sharks". ReefQuest Centre for Shark research. Retrieved 2010-10-16. 
  32. ^ Medina, Samantha (27 July 2007). "Measuring the great white's bite". Cosmos Magazine. Retrieved 1 September 2012. 
  33. ^ a b c d e f "R. Aidan Martin and Anne Martin". "Sociable Killers". "Natural History Magazine, Inc". Retrieved 2006-09-30. 
  34. ^ Johnson, R. L.; A. Venter, M.N. Bester, and W.H. Oosthuizen (2006). "Seabird predation by white shark Carcharodon Carcharias and Cape fur seal Arctocephalus pusillus pusillus at Dyer Island". South African Journal of Wildlife Research (South Africa) 36 (1): 23–32. 
  35. ^ Estrada, J. A.; Aaron N. Rice, Lisa J. Natanson, and Gregory B. Skomal (2006). "Use of isotopic analysis of vertebrae in reconstructing ontogenetic feeding ecology in white sharks". Ecology (USA) 87 (4): 829–834. doi:10.1890/0012-9658(2006)87[829:UOIAOV]2.0.CO;2. ISSN 0012-9658. PMID 16676526. 
  36. ^ "Catch as Catch Can". ReefQuest Centre for Shark Research. Retrieved 2010-10-16. 
  37. ^ "How Fast Can a Shark Swim?". ReefQuest Centre for Shark Research. Retrieved 2010-10-16. 
  38. ^ "White Shark Predatory Behavior at Seal Island". ReefQuest Centre for Shark Research. Retrieved 2010-10-16. 
  39. ^ Martin, Rick. "Predatory Behavior of Pacific Coast White Sharks". Shark Research Committee. Retrieved 2010-10-16. 
  40. ^ a b c d e f g Heithaus, Michael (2001). "Predator–prey and competitive interactions between sharks (order Selachii) and dolphins (suborder Odontoceti): a review". Journal of Zoology (London: Cambridge University Press) 253: 53–68. doi:10.1017/S0952836901000061. Retrieved 2010-02-26. 
  41. ^ Long, Douglas (1991). "Apparent Predation by a White Shark Carcharodon carcharias on a Pygmy Sperm Whale Kogia breviceps". Fishery Bulletin 89: 538–540 
  42. ^ "Monster shark bites great white in half". The Daily Telegraph (Australia). 27 October 2009. Retrieved 19 January 2010. 
  43. ^ Dudley, Sheldon F. J.; Michael D. Anderson-Reade, Greg S. Thompson, and Paul B. McMullen (2000). "Concurrent scavenging off a whale carcass by great white sharks, Carcharodon carcharias, and tiger sharks, Galeocerdo cuvier" (PDF). Marine Biology. Fishery Bulletin. Retrieved 4 May 2010. 
  44. ^ "Great White Shark Feeding On Whale Carcass". wn.com. 
  45. ^ "Natural History of the White Shark". May 2, 2010. 
  46. ^ "Carcharodon carcharias, Great White Sharks". marinebio.org. 
  47. ^ "http://www.elasmo-research.org/education/white_shark/overview.htm". Elasmo Research. Retrieved 20 August 2012. 
  48. ^ R. Aidan Martin. "White Shark Breaching". ReefQuest Centre for Shark Research. Retrieved April 18, 2012. 
  49. ^ Martin, R. A.; Hammerschlag, N.; Collier, R. S.; Fallows, C. (2005). "Predatory behaviour of white sharks (Carcharodon carcharias) at Seal Island, South Africa". Journal of the Marine Biological Association of the UK 85 (5): 1121. doi:10.1017/S002531540501218X.  edit
  50. ^ Rice, Xan (2011-07-19). "Great white shark jumps from sea into research boat". The Guardian (London: Guardian Media Group). Retrieved 2011-07-20. "Marine researchers in South Africa had a narrow escape after a three-metre-long great white shark breached the surface of the sea and leapt into their boat, becoming trapped on deck for more than an hour. [...] Enrico Gennari, an expert on great white sharks, [...] said it was almost certainly an accident rather than an attack on the boat." 
  51. ^ Benchley, Peter (April 2000). "Great white sharks". National Geographic: 12. ISSN 00279358. "considering the knowledge accumulated about sharks in the last 25 years, I couldn't possibly write Jaws today ... not in good conscience anyway ... back then, it was OK to demonize an animal." 
  52. ^ McCabe, Meghan. "Sharks: Killing Machines?" 
  53. ^ Tricas, T.C.; John McCosker (1984). "Proceedings of the California Academy of Sciences". Predatory behavior of the white shark, Carcharodon carcharias, and notes on its biology 43 (14): 221–238. 
  54. ^ "ISAF Statistics for Worldwide Unprovoked White Shark Attacks Since 1990". February 10, 2011. Retrieved 2011-08-19. 
  55. ^ "A Great White Named Schatzi". December 28, 2005. Archived from the original on 2010-01-27. Retrieved 2010-01-19. 
  56. ^ "Muriwai shark most likely a great white". 3 News NZ. February 28, 2013. 
  57. ^ "Shark attack victim's family embrace in sea". Stuff.co.nz. February 28. 
  58. ^ "Sharks and rays". Te Ara, the Encyclopedia of New Zealand. February 27, 2013. 
  59. ^ "Swimmer dies after shark attack". 3 News NZ. February 27, 2013. 
  60. ^ "Unprovoked White Shark Attacks on Kayakers". Shark Research Committee. Retrieved 14 September 2008. 
  61. ^ Tricas and McCosker (1984). Predatory Behaviour of the White Shark.  Unknown parameter |subtitle= ignored (help)
  62. ^ "Great white shark sets record at California aquarium". USA Today. 2004-10-02. Retrieved 2006-09-27. 
  63. ^ Gathright, Alan (2004-09-16). "Great white shark puts jaws on display in aquarium tank". San Francisco Chronicle. Retrieved 2006-09-27. 
  64. ^ "White Shark Research Project". Monterey Bay Aquarium. Retrieved 2006-09-27. 
  65. ^ Squatriglia, Chuck (2003-09-01). "Great white shark introduced at Monterey Bay Aquarium". San Francisco Chronicle. Retrieved 2006-09-27. 
  66. ^ "Learn All About Our New White Shark". "Monterey Bay Aquarium". Retrieved 2009-08-28. 
  67. ^ "Electroreception". Elasmo-research. Retrieved 2006-09-27. 
  68. ^ "Shark cage diving". Department of Environment, Water and Natural Resources. Retrieved 11 March 2013. 
  69. ^ Squires, Nick (1999-01-18). "Swimming With Sharks". BBC. Retrieved 2010-01-21. 
  70. ^ Simon, Bob (2005-12-11). "Swimming With Sharks". 60 Minutes. Retrieved 2010-01-22. 
  71. ^ a b "http://www.bluewaterhunter.com/education/education_successfully.html". Blue Water Hunter. Retrieved 20 August 2012. 
  72. ^ "Shark Attacks Compared to Lightning". Florida Museum of Natural History. 2003-07-18. Retrieved 2006-11-07. 
  73. ^ Hamilton, Richard (2004-04-15). "SA shark attacks blamed on tourism". BBC. Retrieved 2006-10-24. 
  74. ^ "White Shark Manifesto-kelp Forests". World News. Retrieved 20 August 2012. 
  75. ^ "Regulation of Trade in Specimens of Species Included in Appendix II". CITES (1973). Retrieved April 8. 2012. 
  76. ^ "http://www.cms.int/species/sharks/MoU/Migratory_Shark_MoU_Eng.pdf". Retrieved 31 August 2012. 
  77. ^ "Great white sharks to be protected". New Zealand Herald. 2006-11-30. Retrieved 2006-11-30. 
  78. ^ http://newsfeed.time.com/2013/03/04/great-white-sharks-are-now-protected-under-california-law/
  79. ^ http://www.sciencedaily.com/releases/2012/06/120607185514.htm
  80. ^ a b Pyle, Peter; Mary Jane Schramm, Carol Keiper, Scot D. Anderson (26 August 2006). "PREDATION ON A WHITE SHARK (CARCHARODON CARCHARIAS) BY A KILLER WHALE (ORCINUS ORCA) AND A POSSIBLE CASE OF COMPETITIVE DISPLACEMENT". Society of marine mammalogy (USA: Marine Mammal Science) 15 (2): 563–568. doi:10.1111/j.1748-7692.1999.tb00822.x. Retrieved 8 May 2010.  Unknown parameter |unused_data= ignored (help)
  81. ^ a b "Nature Shock Series Premiere: The Whale That Ate the Great White". Tvthrong.co.uk. 1997-10-04. Retrieved 2010-10-16. 
  82. ^ http://www.youtube.com/watch?v=wD2UQ0K-6sI
  83. ^ a b c Turner, Pamela S. (Oct/Nov 2004). "Showdown at Sea: What happens when great white sharks go fin-to-fin with killer whales?". National Wildlife (National Wildlife Federation) 42 (6). Retrieved 2009-11-21. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!