Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An upper slope species (Ref. 10482). Benthic (Ref. 58302).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Large-headed Scorpionfish (Pontinus macrocephalus) is a western Pacific scorpionfish, distributed from Indonesia, east to French Polynesia, north to Japan and Hawaii, and south to Australia and New Caledonia. It has also been reported from Malaysia (Mohsin et al. 1993). The distribution of this species may be more widespread than currently described (R. Fricke pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: southern Japan to Micronesia and the Hawaiian Islands. Reported from Malaysia (Ref. 5756) and from Bali Strait to Timor Sea in Indonesia (Ref. 5978).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Indonesia east to Hawaiian Islands and Tuamotu Archipelago, north to southern Japan, south to Western Australia and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9 - 10; Analspines: 3; Analsoft rays: 5
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

36.5 cm SL (male/unsexed; (Ref. 10482))
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pectoral rays unbranched in adults; with about 45-60 vertical scale rows; lachrymal bone with 2 spines over maxillary, first points out and back, second points mostly back; suborbital ridge with 3 or 4 spines; second preopercular spine usually absent in large specimens; color in life mostly red (Ref. 10482).
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Pontinus spilistius
Catalog Number: USNM 51644
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: South Coast of Oahu Island. Honolulu Light, N. 2 degrees, E. 2.4', Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 386
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Pontinus spilistius
Catalog Number: USNM 51663
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: South Coast of Oahu Island. Honolulu Light, N. 2 degrees, E. 2.4', Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 386
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Large-headed Scorpionfish is a demersal species, found on the upper slope of the continental shelf and oceanic islands. This species is found resting on coralline rock at a depth range of 174–278 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 174 - 278 m (Ref. 10482)
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 238 - 80000
  Temperature range (°C): 11.203 - 15.243
  Nitrate (umol/L): 5.809 - 16.494
  Salinity (PPS): 34.511 - 34.913
  Oxygen (ml/l): 4.345 - 4.418
  Phosphate (umol/l): 0.518 - 1.249
  Silicate (umol/l): 5.251 - 10.458

Graphical representation

Depth range (m): 238 - 80000

Temperature range (°C): 11.203 - 15.243

Nitrate (umol/L): 5.809 - 16.494

Salinity (PPS): 34.511 - 34.913

Oxygen (ml/l): 4.345 - 4.418

Phosphate (umol/l): 0.518 - 1.249

Silicate (umol/l): 5.251 - 10.458
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pontinus macrocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATCTAGTATTTGGTGCTTGAGCTGGCATAGTAGGCACAGCCTTAAGCCTGCTTATTCGAGCAGAACTCAGCCAACCCGGCGCTCTCCTTGGAGAC---GACCAAATTTATAATGTAATCGTTACAGCACACGCCTTTGTAATGATTTTCTTTATAGTTATACCTATTATGATTGGAGGCTTTGGAAATTGGCTTATTCCCATGATGATTGGAGCCCCCGACATGGCATTCCCTCGTATTTATAACATAAGCTTTTGGCTTCTGCCACCTTCTTTCCTCCTACTCCTTGCCTCTTCTGGGGTAGAGGCTGGCGCTGGGACGGGGTGGACAGTTTATCCTCCCCTGGCCGGAAATTTAGCCCACGCAGGCGCATCTGTTGACCTGACAATTTTTTCACTTCACCTAGCAGGTGTTTCCTCAATTCTTGGGGCAATCAACTTTATTACTACAATTATTAATATGAAGCCTCCAGCCATTTCTCAATACCAAACACCTCTGTTTGTCTGAGCCACCCTAATTACCGCCGTCCTGCTCCTTCTCTCCCTCCCCGTCCTGGCTGCCGGCATCACAATGCTTCTCACGGACCGAAACCTCAACACCACCTTCTTCGACCCTGCGGGAGGAGGGGACCCCATCCTGTATCAGCACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pontinus macrocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Fricke, R.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
The Large-headed Scorpionfish (Pontinus macrocephalus) has been assessed as Least Concern. There are no known major threats to this broadly distributed species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for the Large-headed Scorpionfish.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to the Large-headed Scorpionfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place, or needed, for The Large-headed Scorpionfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!