Skip to content

Siganus fuscescens — Details

Dusky Spinefoot learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits algal and seagrass flats and shallow lagoon and coastal reefs (Ref. 9710, 11230). Forms schools. Mainly diurnal. Juveniles feed on filamentous algae, adults feed on leafy algae and seagrasses (Ref. 9710). Commercially cultured in Japan. Commonly found in large estuaries (Ref. 9002). Anterolateral glandular groove with venom gland (Ref. 57406).

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Learn more about this article

Western Pacific: southern Korea, southern Japan, ?Ogasawara Islands, Taiwan, southern China, Malaysia, Singapore, Thailand, Andaman Islands, Indonesia, Philippines, Yap, Palau, Pohnpei (Caroline Islands), Solomon Islands, Papua New Guinea, Vanuatu, New Caledonia, and Australia. Often misidentified as Siganus canaliculatus (Ref. 2334).

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 13; Dorsal soft rays (total): 10; Analspines: 7; Analsoft rays: 9; Vertebrae: 13

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Size

Learn more about this article

Maximum size: 400 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

40.0 cm TL (male/unsexed; (Ref. 9813))

Woodland, D. 1997 Siganidae. Spinefoots, rabbitfishes. p. 3627-3650. In K.E. Carpenter and V. Niem (eds.) FAO Identification Guide for Fishery Purposes. The Western Central Pacific. 837 p. (Ref. 9813) http://www.fishbase.org/references/FBRefSummary.php?id=9813&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Diagnostic Description

Learn more about this article

Body olive green or brown above, silvery below; fish frequently with a dark patch below origin of lateral line. Adults become mottled when frightened. Slender, pungent, venomous spines. Preopercular angle 89°-95°. Lower half to 2/3 of cheeks commonly covered with weak, scattered scales. Midline of thorax between pelvic ridges. Differs from S. argenteus in details of coloration and less deeply forked tail (Ref. 37816).

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Learn more about this article

Depth range based on 615 specimens in 1 taxon.
Water temperature and chemistry ranges based on 309 samples.

Environmental ranges
  Depth range (m): 1 - 92.5
  Temperature range (°C): 23.659 - 29.325
  Nitrate (umol/L): 0.048 - 6.383
  Salinity (PPS): 34.114 - 35.470
  Oxygen (ml/l): 3.378 - 4.703
  Phosphate (umol/l): 0.064 - 0.557
  Silicate (umol/l): 0.872 - 10.066

Graphical representation

Depth range (m): 1 - 92.5

Temperature range (°C): 23.659 - 29.325

Nitrate (umol/L): 0.048 - 6.383

Salinity (PPS): 34.114 - 35.470

Oxygen (ml/l): 3.378 - 4.703

Phosphate (umol/l): 0.064 - 0.557

Silicate (umol/l): 0.872 - 10.066

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Depth: 0 - 50m.
Recorded at 50 meters.

Habitat: reef-associated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Environment

Learn more about this article

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 50 m (Ref. 9813)

Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243) http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Woodland, D. 1997 Siganidae. Spinefoots, rabbitfishes. p. 3627-3650. In K.E. Carpenter and V. Niem (eds.) FAO Identification Guide for Fishery Purposes. The Western Central Pacific. 837 p. (Ref. 9813) http://www.fishbase.org/references/FBRefSummary.php?id=9813&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Migration

Learn more about this article

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.

Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243) http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trophic Strategy

Learn more about this article

Feeds almost continually during daylight and settles at night to sleep. At Heron Is., the young adults at the water's edge under the lip of the beachrock pavement; older adults against the bases of coral clumps on outer reef flat. A sleeping fish adopt a camouflage pattern (Ref. 1419). Aggregates in March, April and May to spawn (Ref. 1363). Also Ref. 58534.

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Diseases and Parasites

Learn more about this article

Hurleytrematoides Infestation 14. Parasitic infestations (protozoa, worms, etc.)

Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836) http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Hexangium Infestation. Parasitic infestations (protozoa, worms, etc.)

Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129) http://www.fishbase.org/references/FBRefSummary.php?id=26129&speccode=1258

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Gyliauchen Infestation. Parasitic infestations (protozoa, worms, etc.)

Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129) http://www.fishbase.org/references/FBRefSummary.php?id=26129&speccode=1258

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Ascaridatosis (adult and juvenile). Parasitic infestations (protozoa, worms, etc.)

Shih, H.-H. and M.-S. Jeng 2002 Hysterothylacium aduncum (Nematoda: Anisakidae) infecting a herbivorous fish Siganus fuscescens, off the Taiwanese coast of the northwest Pacific. Zool. Stud. 41(2):208-215. (Ref. 43904) http://www.fishbase.org/references/FBRefSummary.php?id=43904&speccode=298

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

In Belau, ripe individuals form prespawning congregations of 30-60 individuals in shoal areas of inner reef flats; spawning occurs on the 4th or 5th day of the new moon; spawning sites are near reef edge. About 300,000 eggs/female at a single spawning. Individuals that spawn in consecutive yrs. & that 2+ yr. class fish could spawn more than once in a single season. Aug (Ref 1754) in Belau.

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Siganus fuscescens

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC3571-07|EF025185|Siganus fuscescens| ACACGTTGACTCTTTTCGACTAATCACAAAGACATCGGTACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGTACAGCTTTA---AGCCTACTAATTCGAGCAGAACTTAGCCAACCAGGCGCTCTTCTTGGAGAT---GACCAAATTTATAATGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATG---ATCGGAGCCCCTGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCATCTTTCCTTCTTCTCCTAGCCTCTTCTGGGGTAGAAGCTGGGGCGGGAACTGGTTGAACAGTTTATCCCCCTCTAGCAGGAAATCTAGCACACGCCGGCGCATCCGTAGACCTA---ACTATTTTCTCCCTGCATTTAGCCGGTATTTCATCAATTCTAGGGGCTATTAACTTCATTACAACCATTATTAACATGAAACCTCCTGCTATCTCCCAGTATCAGACCCCTCTCTTCGTATGGGCCGTCCTAATTACAGCTGTCCTTCTTCTTCTTTCCCTACCTGTTCTGGCTGCT---GGAATTACAATGCTCCTAACAGACCGAAACTTAAATACTACATTCTTCGACCCAGCAGGAGGAGGGGACCCGATCCTCTACCAACACCTATTCTGATTCTTTGGCCATCCCGAAGTTTATATTCTTATTCTGCCCGGGTTTGGAATGATTTCCCACATTGTAGCCTACTACTCTGGTAAAAAA---GAACCTTTCGGTTACATGGGTATGGTATGAGCTATGATAGCAATTGGCCTTCTAGGCTTTATTGTCTGAGCACATCACATGTTTACAGTAGGCATGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Siganus fuscescens

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 19
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: commercial; aquaculture: commercial

Woodland, D.J. 1990 Revision of the fish family Siganidae with descriptions of two new species and comments on distribution and biology. Indo-Pacific Fishes (19):136 p. (Ref. 1419) http://www.fishbase.org/references/FBRefSummary.php?id=1419&speccode=4456
Del Norte, A.G.C. and D. Pauly 1990 Virtual population estimates of monthly recruitment and biomass of rabbitfish, Siganus fuscescens off Bolinao, Northern Philippines. p. 851-854. In R. Hirano and I. Hanyu (eds.) The Second Asian Fisheries Forum, Asian Fisheries Society, Manila, Philippines. 991 p. (Ref. 1363) http://www.fishbase.org/references/FBRefSummary.php?id=1363&speccode=4616

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!