Overview

Comprehensive Description

Biology

Inhabits bays and estuaries. Freely enters brackish waters; sometimes enters freshwaters (Ref. 26938). Commonly found around pilings. Caught by anglers from jetties or rocky shores (Ref. 9988). Feeds mainly on mollusks and crustaceans. An excellent food fish. Marketed fresh and frozen; eaten broiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Archosargus probatocephalus is a deep-bodied, compressed fish that reaches 91 cm (35.8 inches) in length, and 9.6 kg (21.2 pounds) or more in weight. The back is elevated behind the head, which is deep and sloping in profile. The snout is short with the mouth inferior and nearly horizontal. The anterior teeth are incisor-like, with posterior molars set further back. There are 6-7 gill rakers on lower limb of the first gill arch. Scales are finely serrate. There is a single dorsal fin, the spinous portion of which is more elongate than the soft portion. There are 12 strong dorsal spines and 10-12 soft rays. The anal fin bears 3 spines, the second of which is the most enlarged, and 10-11 soft rays. The caudal fin is forked. There are 44-49 lateral line scales. Body color is generally gray or green-yellow base color, marked with 5-7 vertical black bars. The dorsal, anal and ventral fins are typically black or gray to dusky, while the caudal and pectoral fins are more greenish in tone. Coloration is more distinct in young fishes (Hildebrand and Schroeder 1927; Hoese and Moore 1977; Johnson 1978). Juvenile sheepshead are brownish in color and have a median line along the ventral surface. In addition to the vertical black bars, there are also 3 black spots: one set behind the isthmus, one beneath the pectoral fin base, and one set anteriorally to the anal fin (Hildebrand and Cable 1938).
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Atlantic and Gulf Coast from Nova Scotia to Brazil; absent from the West Indies and the Bahamas. Common south of Cape Hatteras.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada and northern Gulf of Mexico to Brazil; absent in the Bahamas and West Indies; also absent in Bermuda, Grenada
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada and northern Gulf of Mexico to Brazil. Absent in Bermuda, the Bahamas, the West Indies and Grenada (Ref. 7251, 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Archosargus probatocephalus is common on the Atlantic and Gulf coasts of the United States. Its range extends from Cape Cod, Massachusetts south through Florida and the Gulf of Mexico to Brazil. Wanderers are occasionally observed as far north as Nova Scotia. It is absent from Bermuda, the West Indies and the Bahamas (Jennings 1985). Sheepshead are common throughout the India River Lagoon.
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada and northern Gulf of Mexico to Brazil; (absent in the Bahamas and West Indies).
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Frimodt, C., 1995; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 90 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 9,630 g (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Archosargus probatocephalus grow to approximately 91 cm (35.8 inches) total length (TL) and 9.6 kg (21.2 pounds), though Hildebrand and Schroeder (1927) reported the largest sheepshead recorded weighed 66 kg (145.5 pounds). In most areas, however, sheepshead never achieve this large a size. Maximum lifespan has been estimated at 20 years in Louisiana (Beckman et al. 1991); however most estimates from other regions are lower, ranging from 8 years in North Carolina (Schwartz 1990) to 14 years in Georgia (Music and Pafford 1984). In a Florida study of sheepshead collected from inshore waters, the maximum age for males was estimated to be 13 years, while in females, maximum age was 16 years (MacDonald unpubl. in Murphy 2000).
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 91 cm TL (male/unsexed); max.weight: 9,630.0 g.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Frimodt, C., 1995; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144159
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Corpus Christi Pass, Packery Channel, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 31041
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Locality: Galveston, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144160
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Locality: Vicinity of Corpus Christi, Texas, Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144157
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Ingleside, Texas., San Patricio County, Texas, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144156
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Shamrock Cove, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144155
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1927
Locality: Harbor Island, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144154
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Harbor Island Light, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144153
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Harbor Island Light, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144152
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Harbor Island Light, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 62282
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Snyder
Locality: Tampico, Mexico., Mexico, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 19525
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Museum of Comparative Zoology (MCZ), Harvard University
Year Collected: 1853
Locality: Mobile, Ala, Alabama, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 144158
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Pearson
Year Collected: 1926
Locality: Gulf of Mexico, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Archosargus probatocephalus
Catalog Number: USNM 144151
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1931
Locality: Louisiana. Barataria Bay, Louisiana, United States, Gulf of Mexico, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 726
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Graham
Locality: Indianola, Texas., Calhoun County, Texas, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 730
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Wurdemann
Locality: Brazos Santiago, Texas., Cameron County, Texas, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 728
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Emory
Locality: Brazos, Brazos County, Texas, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Archosargus probatocephalus
Catalog Number: USNM 727
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Couch
Locality: New Orleans, Louisiana, Louisiana, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Mainly bays and estuaries. Adults frequent rocky reefs and jetties, wrecks, oyster beds, and pilings. Juveniles in grass beds over mud bottom. Not uncommon in low salinity situations, but rare in pure fresh water. Spawns along sandy shores (Manooch 1984). Spawning probably occurs offshore (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits bays and estuaries. Freely enters brackish waters; sometimes enters freshwaters.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 15 - ? m (Ref. 9988)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 192 specimens in 1 taxon.
Water temperature and chemistry ranges based on 80 samples.

Environmental ranges
  Depth range (m): 0 - 143.5
  Temperature range (°C): 9.189 - 26.658
  Nitrate (umol/L): 0.289 - 4.051
  Salinity (PPS): 32.968 - 36.266
  Oxygen (ml/l): 4.519 - 6.548
  Phosphate (umol/l): 0.085 - 0.588
  Silicate (umol/l): 0.756 - 3.370

Graphical representation

Depth range (m): 0 - 143.5

Temperature range (°C): 9.189 - 26.658

Nitrate (umol/L): 0.289 - 4.051

Salinity (PPS): 32.968 - 36.266

Oxygen (ml/l): 4.519 - 6.548

Phosphate (umol/l): 0.085 - 0.588

Silicate (umol/l): 0.756 - 3.370
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; brackish; marine; depth range; to 15 m. Inhabits bays and estuaries. Freely enters brackish waters; sometimes enters freshwaters. Commonly found around pilings. Caught by anglers from jetties or rocky shores.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Frimodt, C., 1995; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mollusks, crustaceans, barnacles, and plant material (Lee et al. 1980). Uses teeth to pick up and crush shellfish (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sheepshead are omnivores. The larval diet consists primarily of copepods, amphipods and other zooplankton (Benson 1982). Juveniles under 50 mm (2 inches) in length primarily consume ostracods, gammarids, mysids, copepods and polychaete worms, and bryozoans (Hildebrand and Cable 1938; Springer and Woodburn 1960; Sedberry 1987), but will take any soft-bodied organisms found in seagrasses. After reaching 50 mm (2 inches) in length, there is a dietary shift towards hard-shelled organisms such as bivalve mollusks, brachyurans, echinoderms, and barnacles, though small fishes are opportunistically consumed as well (Odum et al. 1982; Jennings 1985; Sedberry 1978). Adults feed primarily on algae and invertebrates. Ogburn (1984) reported that in North Carolina, sheepshead consumed twice as much algae as invertebrate species. However, Sedberry (1987) reported that for adults of the South Atlantic Bight, bivalves, ascidians and echinoderms were important components of the diet in sheepshead larger than 350 mm (13.8 inches) Standard length (SL). In Georgia, Music and Pafford (1984) reported that sheepshead fed primarily on bryozoans, oysters, decapod shrimp, and barnacles.Habitats: Smaller pelagic larvae are generally collected in surface waters over sandy bottoms, within estuaries, around seawalls or jetties (Spring and Woodburn 1960; Parsons and Peters 1989), nearshore waters, estuaries and bays (Jennings 1985; Parsons and Peters 1989). Juveniles are most common in seagrasses or over muddy bottoms (Odum and Heald 1972; Jennings 1985). Upon reaching approximately 40 mm (1.6 inches) in length by late summer, juveniles begin leaving nursery areas and congregate with adults around stone jetties, piers, wrecks, and breakwaters (Jennings 1985). Adults favor habitats with some amount of topographic relief, and can be common over oyster reefs, piers, breakwaters muddy shallows, wrecks, and in the Gulf of Mexico, oil platforms (Johnson 1978; Jennings 1985). Sheepshead are not truly migratory, but do move to offshore spawning grounds with the onset of cooler water temperatures in late fall and winter (Gilhen et al. 1976; Jennings 1985), and return to nearshore waters and estuaries after spawning takes place in spring. Music and Pafford (1984) found that tagged sheepshead in Georgia never moved more than 100 km (62.5 miles) from their tagging sites, with emigrating fishes leaving estuaries for nearshore reefs close to the sites where they were initially tagged.
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds mainly on mollusks and crustaceans.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Frimodt, C., 1995; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Sheepshead are commonly landed with white mullet, black mullet, jacks, and mojarras (Murphy 2000).
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Archosargus probatocephalus (sheepshead) is prey of:
Chondrichthyes
Tursiops truncatus

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • W. M. Kemp, W. H. B. Smith, H. N. McKellar, M. E. Lehman, M. Homer, D. L. Young and H. T. Odum, Energy cost-benefit analysis applied to power plants near Crystal River, Florida. In: Ecosystem Modeling in Theory and Practice: An Introduction with Case His
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Archosargus probatocephalus (sheepshead) preys on:
producers
benthic invertebrates

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • W. M. Kemp, W. H. B. Smith, H. N. McKellar, M. E. Lehman, M. Homer, D. L. Young and H. T. Odum, Energy cost-benefit analysis applied to power plants near Crystal River, Florida. In: Ecosystem Modeling in Theory and Practice: An Introduction with Case His
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Sheepshead are considered common to abundant throughout the southeastern Atlantic states as well as on the Gulf coast (Jennings 1985).
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds mainly on mollusks and crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in spring; eggs hatch in about 40 hours at 76-77 F (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Archosargus probatocephalus females in Florida and Georgia mature at approximately Age 2 (Tucker 1987). However, they apparently mature at somewhat younger ages in Louisiana, where essentially all males older than Age 2, and females over Age 1 were found to be mature (Render and Wilson 1992). Spawning occurs in late winter and early spring in the coastal mid-Atlantic, south Atlantic and Gulf of Mexico (Springer and Woodburn 1960; Christmas and Waller 1973; Jennings 1985). Off Louisiana, Render and Wilson (1992) reported spawning occurred from late February through late April. In Georgia, spawning occurs primarily in April (Music and Pafford 1992).Though some evidence has been put forward that suggests spawning may occur in estuaries (Render and Wilson 1992), it is generally believed that sheepshead spawn in the nearshore and offshore waters of the continental shelf. Evidence from Music and Pafford (1984) and Render and Wilson (1992) show that females with hydrated oocytes and post-ovulatory females are more commonly collected from nearshore waters than from estuaries during the spawning season. Sheepshead appear to be fractional spawners (Render and Wilson 1992). Estimates of spawning frequency are varied, and range from once per day to once every 20 days. (Murphy 2000). Batch fecundity of females is also widely ranging. Females caught in inshore waters had batch fecundities of 1,100 - 40,000 eggs, while females captured offshore had 14,000 - 250,000 eggs.
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

no information
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Frimodt, C., 1995; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Eggs are buoyant and measure approximately 0.8 mm (0.03 inches) in diameter. They hatch after 40 hours in water temperatures of approximately 25 °C (77 °F). Larvae are pelagic and measure 2 - 4.5 mm (0.08 - 0.2 inches) in length (Johnson 1978). Pigmentation in yolk-sac larvae is restricted to one melanophore set at the angle of the jaw, and 3 melanophores set ventrally posterior to the vent. Most melanophores disappear by the time larvae reach 6 mm (0.24 inches) in length (Mook 1977). Larvae persist for approximately 30-40 days, when metamorphosis to the juvenile stage occurs, typically at lengths of approximately 8mm (0.3 inches) standard length (SL) (Tucker and Alshuth 1996). A study by Parsons and Peters (1989) reported growth rates in both larvae and juveniles of Tampa Bay, Florida as approximately 0.20 mm (0.008 inches) per day. However, a study by Springer and Woodburn (1960) suggests a somewhat faster growth rate of 0.35 mm (0.014 inches) per day, as estimated from average total lengths for young-of-the-year sheepshead in Tampa Bay during June - August.Though few studies exist that show growth rates in older juveniles and adults, Beckman et al. (1991) reported that between Age 1 and Age 2, sheepshead reach approximately 26 cm (10.2 inches); between Age 2 and 3 they reach fork lengths of approximately 30.5 cm (12 inches), and between Age 3 and 4 they reach 35 cm (13.8 inches). In Florida, there is an apparent difference in growth rates between east coast sheepshead and west coast sheepshead, with mean growth rate for Atlantic coast fishes slightly larger at age (through Age 5) than Gulf coast fishes (MacDonald unpubl. in Murphy 2000).
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Archosargus probatocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Archosargus probatocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTTGTATTTGGTGCTTGGGCCGGAATAGTAGGAACTGCCCTAAGCCTGCTCATTCGAGCGGAACTAAGCCAGCCCGGCGCTCTCCTAGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGAAACTGATTAATTCCATTAATGATCGGAGCCCCTGACATAGCATTTCCCCGAATGAACAACATGAGCTTCTGACTGCTTCCCCCATCATTCCTCTTACTACTCGCCTCCTCCGGAGTCGAAGCTGGGGCCGGCACTGGGTGAACTGTTTACCCTCCGCTAGCAGGAAACCTCGCACATGCGGGTGCATCAGTTGACCTAACCATTTTCTCCCTTCACTTGGCTGGAGTTTCATCTATTCTTGGTGCCATTAATTTTATTACCACTATTATTAACATGAAACCTCCTGCCATTTCACAATATCAAACACCGCTATTTGTATGAGCTGTCCTAATCACCGCTGTCCTGCTTCTCCTATCCCTTCCAGTTCTCGCTGCCGGGATCACAATGCTTCTTACAGATCGAAACCTAAACACCACCTTCTTCGACCCTGCCGGAGGAGGGGACCCAATTCTCTATCAACATCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Commercial and Recreational fisheries.Fisheries Importance: Commercial fishery: The sheepshead has limited commercial value, though its importance as a food fish varies with region (Jennings 1985). Murphy (2000) reported annual commercial landings in Florida between 1986-1994 as 790,000 pounds, declining to 310,000 pounds after 1995, coincident with the gill netting ban implemented in 1995 and a minimum size limit of 12 inches. Commercial landings are greatest in the central coast regions of Florida. On the east coast, landings are greatest from Duval and Volusia Counties south to St. Lucie County. On the west coast, landings are concentrated in the Tampa Bay and Charlotte Harbor areas.Between 1987 - 2001, the commercial harvest of Archosargus probatocephalus in Florida totaled 9.2 million pounds, and was valued at $4.9 million. The 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties) accounted for 3.2 million pound of the commercial harvest, which had a value of $1.8 million. This ranks the sheepshead thirty-first in in commercial value to IRL counties, and twentieth in pounds harvested. Recreational Fishery:Sheepshead are significantly more important as a recreational species than a commercial species, with approximately 90-95% of the annual statewide catch taken by recreational anglers (Murphy 2000). Throughout the 1990s, the average annual catch by recreational anglers on the Atlantic coast averaged approximately 1.2 million fish. However, this figure has dropped to an average of 432,000 per year since 1996 (Murphy 2000), with a similar trend noted on Florida's west coast.Within the 5-county area of the Indian River Lagoon, sheepshead are highly prized gamefishes. Recreational anglers captured 1.9 million spotted seatrout between 1997 - 2004 (Table 4, Figure 3), not counting those fishes that were caught and released. The bulk of the recreational catch (47.0%) was taken from inland waters outside of the IRL. Approximately 28.6% of the recreational catch was harvested from IRL waters. Anglers fishing to 3 miles offshore accounted for 21.9% of the harvest, while those fishing up to 200 miles offshore accounted for only 1.8% of the total.
  • Beckman, D.W., A.L. Stanley, J.H. Render, C.A. Wilson. 1991. Age and growth-rate estimating of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish.Bull., U.S. 89:1-8.
  • Gilhen, J., C. G. Gruchy, and D. E. McAllister. 1976. The sheepshead, Archosargus probatocephalus, and the feather blenny, Hypsoblennius hentzi, two additions to the Canadianantic ichthyofauna. Can. Field Nat. 90:42-46.
  • Hildebrand, S. F., and W. C. Schroeder. 1927. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43(1): 366 pp.
  • Hildebrand, S.F. and L.E. Cable. 1938. Further notes on the development and life history of some teleosts at Beaufort, N.C. Bulletin of the U.S. Bureau of Fisheries 48:505-642.
  • Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico: Texas, Louisiana, and adjacent waters. Texas A&M University Press, College Station. 327 pp.
  • Jennings, C.A. 1985. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico) - Sheepshead. U.S. Fish and Wildlife Service Biological Reports 82(11.29). U.S. Army Corps of Engineers, TR EL-82-4. 10 pp.
  • Johnson, D.G. 1978. Development of fishes in the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Vol. 4. Carangidae through Ephippidae. U.S. Fish Wildl. Serv. FWS/OBS- 78/12. 311 pp.
  • Kelly, J. R. 1965. A taxonomic survey of the fishes of Delta National Wildlife Refuge with emphasis upon distribution and abundance. M.S. Thesis. Louisiana State University, Baton Rouge. 133 pp.
  • Mook, D. 1977. Larval and osteological development of the sheepshead Archosargus probatocephalus (Pisces:Sparidae). Copeia 19(1):126-133.
  • Music, J.L., Jr. and J.M. Pafford. 1984. Population dynamics and life history aspects of major marine sportfishes in Georgia's coastal waters. Ga. Dept. Nat. Res., Coastal Res. Div., Coastal Fish Section, Final Report. Study VI Federal Aid Project F-31.
  • Norris, D. E., and R. M. Overstreet. 1975. Thynnascaris reliquens N. and T. habena (Linton I900) (Nematoda:Asoidea) from fishes in the northern Gulf of Mexico and eastern U.S. seaboard. J. Parasitol. 61(2):330-336.
  • Odum, W.E. and E.J. Heald. 1972. Trophic analysis of an estuarine mangrove community. Bull. Mar. Sci. 22(3):671-738.
  • Odum, W. E., C. C. McIvor, and T. J. Smith1982. The ecology of the mangroves of south Florida: a community profile. U.S. Fish Wildl. Serv. FWS/OBS-81/24. 144 PP.
  • Ogburn, M.V. 1984. Feeding ecology and the role of algae in the diet of sheepshead Archosargus probatocephalus (Pisces: Sparidae) on two North Carolina jetties. M.S. Thesis, University of North Carolina at Wilmington.
  • Overstreet, R. M. 1978. Marine maladies? Worms, germs, and other symbionts from the northern Gulf of Mexico. Miss.-Ala. Publ. Ocean Springs, Miss. MASGP- 78-021. 140 pp.
  • Overstreet, R. M., and H. D. Howse. 1977. Some parasites and diseases of estuarine fishes in polluted habitats of Mississippi. Annu. N.Y. Acad. Sci. 298:427-426.
  • Parsons, G.R. and K.M. Peters. 1989. Age determination of larval and juvenile sheepshead, Archosargus probatocephalus. Fish. Bull., U.S. 87:985-988.
  • Perret, W. S. 1971. Cooperative Gulf of Mexico estuarine inventory study. Phase 4, Biology. Pages 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Perret, W. S., and C. W. Caillouet, Jr. 1974. Abundance and size of fishes taken by trawling in Vermilion Bay, Louisiana. Bull. Mar. Sci. 24(10):52-74.
  • Randall, J.E., B. Bishop, and R. Vergaro. 1978. SPARID Archo. In: E. Fischer, ed., FAO species identification sheets for fisheries purposes. West Central Atlantic (fishing area 31). 5:12. Food and Agricultural Organization, U.N., Rome, Italy.
  • Render, J.H. and C.A. Wilson. 1992. Reproductive biology of sheepshead in the northern Gulf of Mexico. Unpublished manuscript, Coastal Fisheries Institute, Center for Coastal Energy and Environmental Resources, Louisiana State University, Baton Rouge, LA 70803-7503.
  • Schwartz, F.J. 1990. Length-weight, age and growth, and landings observations for sheepshead Archosargus probatocephalus from North Carolina. Fish. Bull., U.S. 88:829-832.
  • Sedberry, G.R. 1987. Feeding habits of sheepshead, Archosargus probatocephalus, in inshore reef habitats of the southeastern continental shelf. Northeast Gulf Science 9:29-37.
  • Springer, V.G. and K.D. Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Lab. Prof. Pap. Ser. 1:1-104.
  • Tucker. J.W., Jr. 1987. Sheepshead culture and preliminary evaluation for farming. Progressive Fish-Culturist 49:224-228.
  • Tucker, J.W., Jr. and S.R. Alshuth. 1997. Development of laboratory-reared sheepshead, Archosargus probatocephalus (Pisces: Sparidae). Fish. Bull., U.S. 95:399-401.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Archosargus probatocephalus

For other uses, see Sheepshead (disambiguation).

The sheepshead, Archosargus probatocephalus, is a marine fish that grows to 30 in (760 mm), but commonly reaches 10 to 20 in. It is deep and compressed in body shape, with five or six dark bars on the side of the body over a gray background. It has sharp dorsal spines. Its diet consists of oysters, clams, and other bivalves, and barnacles, fiddler crabs, and other crustaceans.[1] It has a hard mouth, with several rows of stubby teeth, which help crush the shells of prey.[2]

Fishing[edit]

Although the Sheepshead Bay section of Brooklyn, in New York City, was named after the fish,[3] it is almost entirely a southern species: its range extends from the mid-Atlantic to Texas.[1] As sheepshead feed on bivalves and crustaceans,[1] successful baits include shrimp, sand fleas (mole crabs), clams, fiddler crabs, and mussels.[4] Sheepshead have a knack for stealing bait, so a small hook is necessary.[4] Locating sheepshead with a boat is not difficult: Fishermen look for rocky bottoms or places with obstructions, jetties, and the pilings of bridges and piers.[4] The average weight of a sheepshead is 3 to 4 lb, but some individuals reach the range of 10 to 15 lb.[4]

References[edit]

  1. ^ a b c "Sheepshead (Archosargus probatocephalus)". Tpwd.state.tx.us. Retrieved 2013-01-04. 
  2. ^ "No Braces Necessary for the Sheepshead Fish With Human-like Teeth". thefeaturedcreature.com. 
  3. ^ "The Naming of Sheepshead Bay". Brooklyn Based. Retrieved 2013-01-04. 
  4. ^ a b c d Gillis, Chad (March 6, 2008). "Fishing 101: Sheepshead Porgy". naplesnews.com. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Three subspecies have been recognized: PROBATOCEPHALUS, ARIES, and OVICEPS. Populations south and west of Cedar Key, Florida, have been regarded as a distinct species by at least one author, but most accounts maintain those populations within A. PROBATOCEPHALUS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!