Skip to content

Polypterus ornatipinnis — Details

Ornate Bichir learn more about names for this taxon

Overview

Comprehensive Description

General Description

Learn more about this article

From Boulenger 1909, pp. 12-13.

Head 1½ times as long as broad, 6 times in total length; snout projecting very slightly beyond lower jaw; eye lateral, 8½ times in length of head, 3 times in width of interorbital region, which is slightly convex; all head-shields paired; a series of 4 shields between postorbital and spiracular shields suboperculum slightly larger than eye. Dorsal with X-XI spines, not overlapping when folded. Anal 15. Pectoral widely separated from first dorsal spine. 62-63 scales in a longitudinal series, 24-25 between occiput and first dorsal spine, 42 round middle of body. Olive above, with ill-defined light spots, whitish beneath; lips and gill-membrane spotted with black; dorsal fin spotted with black; pectorals, ventrals, anal, and caudal barred with black.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Sullivan, John P.

Source: AFRICHTHY

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Biology

Learn more about this article

Inhabits calm waters of swamps and rivers (Ref. 11970). It feeds on worms and insect larvae when young, but takes larger food, mainly fish, when adult (Ref. 27292). It mainly hunts at night (Ref. 27292). In general they are more or less solitary fish and do not form schools (Ref. 27292).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Range Description

Learn more about this article

This species is known from Cameroon to Angola, and east to Tanzania.

Central Africa: Polypterus ornatipinnis is known from throughout the Congo River basin with exception of the Mweru-Luapula-Bangweulu system.

Eastern Africa: It is present in the Lower Malagarasi and its delta with Lake Tanganyika (De Vos et al. 2001, Seegers 1996), and Lake Rukwa basin (Seegers 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Learn more about this article

Congo Basin

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Sullivan, John P.

Source: AFRICHTHY

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Africa: Congo River basin (Democratic Republic of the Congo, Angola, Cameroon) (Ref. 3188); Lake Rukwa drainage (Ref. 27292) and Lake Tanganyika (Ref. 4537, Ref. 36901).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 911; Analspines: 1415

Poll, M. 1967 Contribution à la faune ichthyologique de l'Angola. Diamang Publ. Cult., nr. 75:381 p. (Ref. 11970) http://www.fishbase.org/references/FBRefSummary.php?id=11970&speccode=11087

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Size

Learn more about this article

Maximum size: 600 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

60.0 cm TL (male/unsexed; (Ref. 3188))

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Diagnostic Description

Learn more about this article

Subcylindrical body (Ref. 27292, Ref. 36901). Upper and lower jaw of equal length (Ref. 36901, Ref. 42907). Number of dorsal finlets: 9-11 (Ref. 42908, Ref. 51884). Dorsal fin origin well behind pectoral fin (Ref. 4967, Ref. 42873). Ganoid scales (Ref. 27292, Ref. 42904): 58-65 lateral line scales, 38-44 scales around body, 22-27 predorsal scales (Ref. 2970, Ref. 11970, Ref. 42907, Ref. 42908). Dorsal side grey-brown colored, marbled with clear whitish spots (Ref. 11970), the belly is white to yellowish (Ref. 27292). Head finely reticulated (Ref. 42873, Ref. 42901). Fins with white spots alternating with dark spots, forming a continuous bar (Ref. 11970).

Poll, M. 1967 Contribution à la faune ichthyologique de l'Angola. Diamang Publ. Cult., nr. 75:381 p. (Ref. 11970) http://www.fishbase.org/references/FBRefSummary.php?id=11970&speccode=11087

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology

Polypterus ornatipinnis is a demersal, air breathing species. In contrast to Polypterus endlicheri congicus which is found in the main river channels, this species prefers small ditches and swamps (Poll 1967, Seegers 1996). It feeds on worms and insect larvae when young, but takes larger food, mainly fish, when adult (Seegers 1996). Polypterus ornatipinnis mainly hunts at night (Seegers 1996). In general they are more or less solitary fish and do not form schools (Seegers 1996). The male starts with the balts and is the active partner (Riehl and Baensch 1991). The male makes a sort of cup from the anal fin and the female lays the eggs in this cup (Riehl and Baensch 1991). Probably spawns in the rainy season (Seegers 1996).

Systems

Freshwater

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Environment

Learn more about this article

demersal; freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trophic Strategy

Learn more about this article

Inhabits calmer waters of rivers (Ref. 11970). Feeds on worms and insect larvae when young, but takes larger food, mainly fish, when adult (Ref. 27292). It hunts mainly at night (Ref. 27292).

Poll, M. 1967 Contribution à la faune ichthyologique de l'Angola. Diamang Publ. Cult., nr. 75:381 p. (Ref. 11970) http://www.fishbase.org/references/FBRefSummary.php?id=11970&speccode=11087

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Male starts with the balts and is the active partner (Ref. 1672). The male makes from the anal fin a sort of cup and the female lays the eggs in this cup (Ref. 1672).

Riehl, R. and H.A. Baensch 1991 Aquarien Atlas. Band. 1. Melle: Mergus, Verlag für Natur- und Heimtierkunde, Germany. 992 p. (Ref. 1672) http://www.fishbase.org/references/FBRefSummary.php?id=1672&speccode=5234

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Polypterus ornatipinnis

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC1495-06|NC_001778|Polypterus ornatipinnis| ACCCGCTGACTTTTCTCAACAAACCACAAAGACATTGGCACCCTTGATTTAATCTTTGGTGCCTGAGCCGGAATAGTAGGAACCGCACTA---AGCCTCCTAATTCGCGCAGAACTAGGCCAACCAGGAGCCCTAATAGGAGAT---GACCAAATTTATAATGTTGTCGGCACTGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATCGGAGGATTCGGTAACTGACTTGTACCACTAATA---ATTGGAGCCCCAGATATGGCCTTCCCACGAATAAATAACATAAGTTTCTGATTACTTCCACCATCGCTTCTCCTGCTACTAACCTCTTCTGCAGTAGAGGCCGGTGTCGGAACAGGATGAACTGTATATCCCCCATTAGGCGGGAATCTAGCACATGCAGGGGCATCAGTTGATTTA---GCAATTTTCTCACTCCATTTAGTCGGTGTTTCCTCAATTCTTGGGGCAATTAACTTCATTACTACAATTATTAATATGAAACCGCCATCCACCTCACAATACCAAACCCCCCTATTCGTATGATCAGTATTAGTCACTGCAGTCCTCTTACTCCTATCCCTTCCAGTATTAGCCGCC---GGAATTACAATACTACTAACAGATCGAAATTTAAACACTACCTTCTTTGACCCTGCTGGCGGAGGAGATCCAATTCTTTACCAACATTTATTCTGATTTTTTGGCCATCCAGAAGTATACATTTTAATTCTTCCAGGATTTGGTATAGTCTCTCATATCGTAGCTTACTATTCAGGTAAAAAT---GAACCTTTCGGTTATATAGGAATAGTATGAGCAATAATAGCGATTGGACTCCTAGGATTTATCGTATGAGCCCACCACATATTTACAGTTGGTATAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Polypterus ornatipinnis

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Hanssens, M. & Moelants, T.

Reviewer/s

Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification

This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central Africa. In eastern Africa, it is assessed as Near Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trends

Population

Learn more about this article

Population

No estimates, but rather rare in fisheries catches

Population Trend

Unknown

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats

In parts of its range, this species is threatened by fisheries, and changes in swamp biotopes due to agriculture extension.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

None known. Population trends should be monitored, and habitat conservation is needed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: of no interest; aquarium: public aquariums

Eccles, D.H. 1992 FAO species identification sheets for fishery purposes. Field guide to the freshwater fishes of Tanzania. Prepared and published with the support of the United Nations Development Programme (project URT/87/016). FAO, Rome. 145 p. (Ref. 4967) http://www.fishbase.org/references/FBRefSummary.php?id=4967&speccode=11098
Riehl, R. and H.A. Baensch 1991 Aquarien Atlas. Band. 1. Melle: Mergus, Verlag für Natur- und Heimtierkunde, Germany. 992 p. (Ref. 1672) http://www.fishbase.org/references/FBRefSummary.php?id=1672&speccode=5234

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Polypterus ornatipinnis

Learn more about this article

The Ornate Bichir (Polypterus ornatipinnis) is a bony fish that lives in Lake Tanganyika and the Congo River basin in Central and East Africa.

Description

P. ornatipinnis has black and yellow patterning on its body, head, and fins, with 9 to 11 dorsal spines. It is the largest of the Polypterus species with a protruding upper jaw,^[1] reaching 24 inches (61 cm) in length. This fish can range colours from dark brown to brownish grey and is very common in the aquarium trade, like many other bichirs, this fish also has a primitive pair of lungs enabling it to survive out of water for a short time. It has two eyes on the sides on its head, two pectoral fins and is one of the most attractive of the bichirs.^[2]

Notes

^ ^a ^b Evans, Sean. "Polypterus ornatipinnis". Polypterus.info. http://www.polypterus.info/p_ornatipinnis.htm. Retrieved 2008-08-16.
^ From the exhibit caption at the New England Aquarium, 2008.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!