Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit silty lagoons and harbors. Monogamous (Ref. 55367). A protandrous hermaphrodite (Ref. 32166). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Heteractis crispa and Stichodactyla haddoni (Ref. 5911). Has been reared in captivity (Ref. 35420, 35423).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Ryukyu Islands, China, Viet Nam, Taiwan, Gulf of Thailand, Indonesia, Philippines, Australia (Northern Territory, Gulf of Carpentaria), New Guinea, New Britain, and Solomon Islands (Ref. 7247). Recorded from Singapore (Ref. 85309).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific and northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 16 - 18; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by the third white band on the tail that is missing or as a saddle-like marking in A. sebae. Some geographical variations and in PNG often with much orange ventrally (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 2 - 30 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 3 - 23
  Temperature range (°C): 26.173 - 28.409
  Nitrate (umol/L): 0.069 - 0.617
  Salinity (PPS): 33.568 - 35.263
  Oxygen (ml/l): 4.450 - 4.677
  Phosphate (umol/l): 0.099 - 0.191
  Silicate (umol/l): 0.506 - 1.900

Graphical representation

Depth range (m): 3 - 23

Temperature range (°C): 26.173 - 28.409

Nitrate (umol/L): 0.069 - 0.617

Salinity (PPS): 33.568 - 35.263

Oxygen (ml/l): 4.450 - 4.677

Phosphate (umol/l): 0.099 - 0.191

Silicate (umol/l): 0.506 - 1.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits silty lagoons and harbors (Ref. 7247). Commensal with anemones (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Benthic spawner. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Length at sex change = 9.2 cm TL (Ref. 55367). Also Ref. 240, 7471.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion polymnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTCTTAGGAGATGATCAAATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTCTAATTGGAGGATTTGGAAACTGACTAGTGCCCCTCATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTTCTGCTTGCCTCCTCAGGAGTTGAAGCCGGGGCAGGAACAGGCTGAACTGTTTACCCACCACTGTCTGGAAACCTAGCCCATGCAGGAGCATCAGTAGACTTAACTATCTTCTCTCTCCACCTAGCAGGTGTCTCATCAATTCTGGGCGCAATCAACTTTATCACTACCATTATCAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCCCTATTTGTTTGAGCTGTTCTAATTACTGCTGTTCTTCTTCTCCTTTCCCTTCCAGTTTTAGCTGCCGGTATTACTATGCTCTTAACGGACCGAAATCTAAATACTACCTTCTTTGACCCGGCAGGAGGAGGAGATCCAATTCTCTACCAACACCTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion polymnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Saddleback clownfish

Amphiprion polymnus, also known as the saddleback clownfish or yellowfin anemonefish, is a Marine fish belonging to the family Pomacentridae which gathers clownfishes and damselfishes.[2]

Description[edit]

The Saddleback clownfish is a small sized fish which grows up to 13 centimetres (5.1 in). Its body has a stock appearance, oval shape, compressed laterally and with a round profile.[3]

Color ranges from dark brown to yellow orange with a thick white bar located just behind the eyes. A large white abbreviated saddle shape or slanted white bar across the middle of the fish's body makes it quite obvious to see how it got the name Saddleback.[4] In some varieties, typically those specimens initially associated with H. crispa anemone,[4] the saddle shape may extend up onto the fish's Dorsal fin with a third white bar or margin located across the caudal peduncle (pictured in taxobox).

Melanistic variation has also been partially correlated with the fish's host anemone. Specimens associated with H. crispa tend to be darker than those associated with S. haddoni. Aquarium specimens have been observed becoming lighter or darker after accepting a new host anemone species, sometimes within a few hours.[4] The external edge of the caudal and the anal fins are underlined with a white line. The snout and the pectoral fin are in any case of color variation orange yellow to brownish orange.[5]

Distribution[edit]

The Saddleback clownfish is found in the center of the Indo-Pacific area.[6]

Habitat[edit]

A group of saddleback anemonefish over their carpet anemone home from East Timor.

Adults inhabit silty lagoons and harbour areas in depth range from 2 to 30 metres (1,200 in).[7] Like most clownfish, they are most often observed living in a symbiotic relationship with a host anemone for protection and in the wild are most often seen in association with Stichodactyla haddoni (Saddle carpet anemone) or Heteractis crispa (Sebae anemone[5]).

Feeding[edit]

This anemonefish is omnivorous and its diet is based on zooplankton, small benthic crustaceans and algaes.[8]

Behaviour[edit]

Amphiprion polymnus has a diurnal activity. It is protrandous hermaphrodite, which means the male can evolved to female during his life, and lives in harem in which an established dominance hierarchy manages the group and keeps individuals at a specific social rank.

It is also an aggressive, territorial animal and it is completely dependent from its sea anemone which it uses as a shelter for the group and for the nest.

The associative relationship that binds the clownfish and the sea anemone is called mutualism.In one hand, the fish can lives within the sea anemone's tentacles and uses it as a shelter because it has developed a thin layer of mucus which covers its body as a protection against the stinging anemone's tentacles. On the other hand, the presence of the clownfish can be interpreted as a lure to attract the anemone's prey close to the tentacles. The clownfish can also defend the anemone against some reef fishes which could eat the tentacles such as butterflyfishes.[5]

The male and the female Amphiprion Polymnus' are almost equal in size while for the other species of Clownfishes females are the biggest. Both species of sea anemone, which the Saddleback clownfish is in association with, are known to bury themselves when they are under stress. In that case, the clownfish is not able to hide in the reef as would have done another species of clownfish, so it has adapted itself by having males as big as the females to limit the predation.[9]

Captivity[edit]

To be kept in an aquarium this species will do best in tanks of at least 30 US gallons (110 l) or larger, preferably aquascaped with live rock to allow multiple choices for hiding places. They should be fed small amounts of food, such as staple marine flake food with occasional frozen mysis shrimp or other small crustacean, two to three times per day.

The protection of a host anemone is not required in an aquarium and attempting to keep either of the species of anemones commonly associated with this clownfish in a captive aquarium environment is not recommended, even for experienced aquarists. This is due to the poor survival rate of wild collected specimens and the overall shortened lifespans these normally centarian organisms often experience in captivity.

See also[edit]

Clownfish Coral reef Fish

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!