Overview

Comprehensive Description

Biology

Inhabits sandy or low-relief rocky bottoms (Ref. 11228). Feeds on bottom-living invertebrates. Marketed fresh (Ref. 9775).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: east Africa and Seychelles to the Solomon Islands, north to southern Japan, south to northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comores, Kenya, Madagascar, Mozambique, Seychelles, Somalia, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 2295))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Lower edge of eye is intersected by line from snout tip to the middle of the caudal fin fork. Eye diameter usually about equal to the length of the snout. The interorbital space is convex and about equal to eye diameter. The inner surface of the pectoral fin axil is scaleless. Overall color is silver, sometimes slightly brown dorsally, with about eight transverse brown bars on the sides, the first crossing through the eye, the remainder below the dorsal fin and across the caudal peduncle. Scattered blotches and speckling is sometimes evident on sides. Fins are clear to yellow-orange with caudal margins and tips often deep red.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits trawling grounds of the continental shelf. Feeds on bottom-living invertebrates.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; non-migratory; marine; depth range 50 - 100 m (Ref. 2295)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 358 specimens in 1 taxon.
Water temperature and chemistry ranges based on 240 samples.

Environmental ranges
  Depth range (m): 5 - 114
  Temperature range (°C): 21.088 - 27.844
  Nitrate (umol/L): 0.019 - 9.015
  Salinity (PPS): 34.534 - 35.245
  Oxygen (ml/l): 3.284 - 4.701
  Phosphate (umol/l): 0.152 - 0.760
  Silicate (umol/l): 0.897 - 11.713

Graphical representation

Depth range (m): 5 - 114

Temperature range (°C): 21.088 - 27.844

Nitrate (umol/L): 0.019 - 9.015

Salinity (PPS): 34.534 - 35.245

Oxygen (ml/l): 3.284 - 4.701

Phosphate (umol/l): 0.152 - 0.760

Silicate (umol/l): 0.897 - 11.713
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 50 - 100m.
From 50 to 100 meters.

Habitat: demersal. Inhabits sandy or low-relief rocky bottoms (Ref. 11228). Feeds on bottom-living invertebrates. Marketed fresh (Ref. 9775).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154). In sandy areas and rocky reefs (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnocranius elongatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTCGGTGCATGAGCTGGAATAGTCGGCACTGCTCTGAGCCTCCTTATCCGAGCGGAGCTTAGTCAACCTGGGGCTCTCCTGGGAGACGACCAGATTTACAATGTAATCGTTACAGCACACGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATCGGAGGCTTTGGAAATTGACTTATTCCACTAATGATCGGAGCCCCCGATATGGCATTCCCTCGAATGAATAATATAAGCTTCTGACTTCTTCCCCCTTCCTTCCTCCTTCTCCTAGCCTCCTCAGGTATTGAAGCCGGAGCAGGAACCGGATGAACAGTCTACCCCCCACTAGCCGGCAACCTTGCCCACGCTGGAGCATCCGTTGACCTAACCATCTTCTCTCTCCACCTAGCTGGTATTTCCTCAATCCTGGGTGCTATTAACTTTATTACAACCATCATCAACATGAAACCACCTGCTATCTCTCAATACCAGACCCCCCTCTTCGTCTGAGCAGTCCTAATCACTGCTGTCCTCCTTCTCCTCTCACTCCCAGTCTTGGCAGCAGGCATCACAATACTCCTTACGGACCGAAACTTAAATACAACCTTCTTTGACCCTGCGGGCGGAGGAGATCCAATTCTCTACCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnocranius elongatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!