Overview
Comprehensive Description
Biology
Inhabits sandy or low-relief rocky bottoms (Ref. 11228). Feeds on bottom-living invertebrates. Marketed fresh (Ref. 9775).
-
Carpenter, K.E. and G.R. Allen 1989 FAO Species Catalogue. Vol. 9. Emperor fishes and large-eye breams of the world (family Lethrinidae). An annotated and illustrated catalogue of lethrinid species known to date. FAO Fish. Synop. 125(9):118 p. Rome: FAO. (Ref. 2295)
http://www.fishbase.org/references/FBRefSummary.php?id=2295&speccode=1832
Trusted
Distribution
Indo-West Pacific: east Africa and Seychelles to the Solomon Islands, north to southern Japan, south to northern Australia.
-
Heemstra, P.C. 1995 Additions and corrections for the 1995 impression. p. v-xv. In M.M. Smith and P.C. Heemstra (eds.) Revised Edition of Smiths' Sea Fishes. Springer-Verlag, Berlin. (Ref. 11228)
http://www.fishbase.org/references/FBRefSummary.php?id=11228&speccode=506
Trusted
Comores, Kenya, Madagascar, Mozambique, Seychelles, Somalia, Tanzania
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Physical Description
Morphology
Dorsal spines (total): 10; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 10
-
Carpenter, K.E. and G.R. Allen 1989 FAO Species Catalogue. Vol. 9. Emperor fishes and large-eye breams of the world (family Lethrinidae). An annotated and illustrated catalogue of lethrinid species known to date. FAO Fish. Synop. 125(9):118 p. Rome: FAO. (Ref. 2295)
http://www.fishbase.org/references/FBRefSummary.php?id=2295&speccode=1832
Trusted
Size
Max. size
35.0 cm TL (male/unsexed; (Ref. 2295))
-
Carpenter, K.E. and G.R. Allen 1989 FAO Species Catalogue. Vol. 9. Emperor fishes and large-eye breams of the world (family Lethrinidae). An annotated and illustrated catalogue of lethrinid species known to date. FAO Fish. Synop. 125(9):118 p. Rome: FAO. (Ref. 2295)
http://www.fishbase.org/references/FBRefSummary.php?id=2295&speccode=1832
Trusted
Diagnostic Description
Lower edge of eye is intersected by line from snout tip to the middle of the caudal fin fork. Eye diameter usually about equal to the length of the snout. The interorbital space is convex and about equal to eye diameter. The inner surface of the pectoral fin axil is scaleless. Overall color is silver, sometimes slightly brown dorsally, with about eight transverse brown bars on the sides, the first crossing through the eye, the remainder below the dorsal fin and across the caudal peduncle. Scattered blotches and speckling is sometimes evident on sides. Fins are clear to yellow-orange with caudal margins and tips often deep red.
-
Carpenter, K.E. and G.R. Allen 1989 FAO Species Catalogue. Vol. 9. Emperor fishes and large-eye breams of the world (family Lethrinidae). An annotated and illustrated catalogue of lethrinid species known to date. FAO Fish. Synop. 125(9):118 p. Rome: FAO. (Ref. 2295)
http://www.fishbase.org/references/FBRefSummary.php?id=2295&speccode=1832
Trusted
Description
Inhabits trawling grounds of the continental shelf. Feeds on bottom-living invertebrates.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
demersal; non-migratory; marine; depth range 50 - 100 m (Ref. 2295)
-
Carpenter, K.E. and G.R. Allen 1989 FAO Species Catalogue. Vol. 9. Emperor fishes and large-eye breams of the world (family Lethrinidae). An annotated and illustrated catalogue of lethrinid species known to date. FAO Fish. Synop. 125(9):118 p. Rome: FAO. (Ref. 2295)
http://www.fishbase.org/references/FBRefSummary.php?id=2295&speccode=1832
Trusted
Depth range based on 358 specimens in 1 taxon.
Water temperature and chemistry ranges based on 240 samples.
Environmental ranges
Depth range (m): 5 - 114
Temperature range (°C): 21.088 - 27.844
Nitrate (umol/L): 0.019 - 9.015
Salinity (PPS): 34.534 - 35.245
Oxygen (ml/l): 3.284 - 4.701
Phosphate (umol/l): 0.152 - 0.760
Silicate (umol/l): 0.897 - 11.713
Graphical representation
Depth range (m): 5 - 114
Temperature range (°C): 21.088 - 27.844
Nitrate (umol/L): 0.019 - 9.015
Salinity (PPS): 34.534 - 35.245
Oxygen (ml/l): 3.284 - 4.701
Phosphate (umol/l): 0.152 - 0.760
Silicate (umol/l): 0.897 - 11.713
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 240 samples.
Environmental ranges
Depth range (m): 5 - 114
Temperature range (°C): 21.088 - 27.844
Nitrate (umol/L): 0.019 - 9.015
Salinity (PPS): 34.534 - 35.245
Oxygen (ml/l): 3.284 - 4.701
Phosphate (umol/l): 0.152 - 0.760
Silicate (umol/l): 0.897 - 11.713
Graphical representation
Depth range (m): 5 - 114
Temperature range (°C): 21.088 - 27.844
Nitrate (umol/L): 0.019 - 9.015
Salinity (PPS): 34.534 - 35.245
Oxygen (ml/l): 3.284 - 4.701
Phosphate (umol/l): 0.152 - 0.760
Silicate (umol/l): 0.897 - 11.713
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 50 - 100m.
From 50 to 100 meters.
Habitat: demersal. Inhabits sandy or low-relief rocky bottoms (Ref. 11228). Feeds on bottom-living invertebrates. Marketed fresh (Ref. 9775).
From 50 to 100 meters.
Habitat: demersal. Inhabits sandy or low-relief rocky bottoms (Ref. 11228). Feeds on bottom-living invertebrates. Marketed fresh (Ref. 9775).
Trusted
Trophic Strategy
Found on the continental shelf (Ref. 75154). In sandy areas and rocky reefs (Ref. 9137).
-
Carpenter, K.E. and G.R. Allen 1989 FAO Species Catalogue. Vol. 9. Emperor fishes and large-eye breams of the world (family Lethrinidae). An annotated and illustrated catalogue of lethrinid species known to date. FAO Fish. Synop. 125(9):118 p. Rome: FAO. (Ref. 2295)
http://www.fishbase.org/references/FBRefSummary.php?id=2295&speccode=1832
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gymnocranius elongatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTATTTAGTATTCGGTGCATGAGCTGGAATAGTCGGCACTGCTCTGAGCCTCCTTATCCGAGCGGAGCTTAGTCAACCTGGGGCTCTCCTGGGAGACGACCAGATTTACAATGTAATCGTTACAGCACACGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATCGGAGGCTTTGGAAATTGACTTATTCCACTAATGATCGGAGCCCCCGATATGGCATTCCCTCGAATGAATAATATAAGCTTCTGACTTCTTCCCCCTTCCTTCCTCCTTCTCCTAGCCTCCTCAGGTATTGAAGCCGGAGCAGGAACCGGATGAACAGTCTACCCCCCACTAGCCGGCAACCTTGCCCACGCTGGAGCATCCGTTGACCTAACCATCTTCTCTCTCCACCTAGCTGGTATTTCCTCAATCCTGGGTGCTATTAACTTTATTACAACCATCATCAACATGAAACCACCTGCTATCTCTCAATACCAGACCCCCCTCTTCGTCTGAGCAGTCCTAATCACTGCTGTCCTCCTTCTCCTCTCACTCCCAGTCTTGGCAGCAGGCATCACAATACTCCTTACGGACCGAAACTTAAATACAACCTTCTTTGACCCTGCGGGCGGAGGAGATCCAATTCTCTACCAACACCTGTTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Gymnocranius elongatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
-
Carpenter, K.E. 1997 Lethrinidae. Emperor snappers. In K.E. Carpenter and V. Niem (eds.) FAO Identification Guide for Fishery Purposes. The Western Central Pacific. (Ref. 9775)
http://www.fishbase.org/references/FBRefSummary.php?id=9775&speccode=1834
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


