Overview

Comprehensive Description

Biology

Inhabit outer reef slopes with moderate coral growth (Ref. 9710). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This west Indian Ocean species ranges along the East African coast from Kenya to Bashee (South Africa); with populations also present at Madagascar and the Mascarene Islands (Mauritius Islands and Réunion [France] and Rodriguez) (Allen 1980, G.R. Allen pers. comm. 2006). It has been recorded at depths from 10-55 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Kenya to about 33°S, Madagascar, and Mauritius.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: East and South Africa (Kenya to 33°S) to Madagascar and Mascarenes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 16; Dorsal soft rays (total): 21 - 23; Analspines: 3; Analsoft rays: 17 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found on rocky reefs with some coral growth. It occurs alone or in pairs. It is an omnivorous species which feeds on small benthic invertebrates (e.g., amphipods and polychaetes) and zooplankton (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range ? - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 15.5 - 80

Graphical representation

Depth range (m): 15.5 - 80
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Brownburnie. Attains 12 cm. Inhabits outer reef slopes with moderate coral growth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits outer reef slopes with moderate coral growth (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon blackburnii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACCGCTTTAAGTCTACTCATCCGAGCAGAGCTCAGTCAACCAGGTACCCTTTTAGGCGATGATCAAATCTATAATGTAATCGTTACGGCACATGCGTTCGTGATGATTTTCTTTATAGTAATACCAATTATGATTGGGGGATTTGGAAACTGACTAATTCCTCTAATGATTGGAGCTCCTGATATAGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTCCTACCCCCTTCTTTTTTCCTCCTACTTGCCTCTTCTGGTGTAGAGTCCGGGGCTGGTACCGGATGAACGGTTTATCCCCCACTGGCCGGTAACCTGGCACATGCCGGAGCATCCGTNGACCTAACTATCTTCTCTCTTCACCTTGCAGGTATTTCCTCCATTCTAGGGGCTATAAACTTCATTACAACAATCCTTAATATGAAGCCCCCCGCCATATCTAAGTATCAAACCCCCCTCTTCGTATGATCCGTCCTAATTACAGCTGTCCTCCTTCTTCTATCTCTTCCTGTTCTTGCAGCCGGGATTACCATGCTCCTAACAGATCGAAACCTAAACACGACCTTTTTCGACCCAGCAGGGGGTGGTGACCCTATTCTGTATCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon blackburnii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
While this species is restricted to the southwest Indian Ocean and found mostly on rocky reefs, there are no known major threats and the population is unlikely to be declining. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

It is generally common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection is limited and is not considered to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is likely present within marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!