Overview

Brief Summary

Biology

This species often rests on the bottom with the saw held upwards at an angle (6). It feeds on slow-moving fish that form shoals, including mullet, which are tackled by swiping at them with the side of the saw; they may also remove crustaceans and molluscs from the sediment by using the saw to rake them out (4). Like other sharks and rays, fertilisation is internal and females give birth to live young (4). At birth, the saws have a gelatinous coating which protects the mother (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The green sawfish is a ray, with a shark-like body and a striking elongated snout, known as a saw. This saw bears 23-37 pairs of teeth and earns the species its common name (4) (5). This sawfish is greenish brown or olive in colour, with pale white to yellowish underparts (5) (6). At maturity, males reach impressive lengths of up to 430 cm. Female lengths are not known, but it is thought that they reach similar sizes as males (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inshore and intertidal species known to enter freshwater in some areas (Ref. 9859). Found in shallow bays, estuaries, and lagoons (Ref. 11228). Often on the bottom with its saw elevated at an angle to the body axis (Ref. 9859). Feeds on fishes and shellfishes (Ref. 58784). Ovoviviparous (Ref. 50449). Flesh considered tasty (Ref. 11228).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Green Sawfish have a broad Indo-West Pacific distribution, from South Africa north along the east coast of Africa, through the Red Sea, Persian (Arabian) Gulf, southern Asia, Indo-Australian archipelago, and east Asia as far north as Taiwan and southern China (Fowler 1941, Blegvad and Løppenthin 1944, Smith 1945, Misra 1969, Compagno et al. 2002a, 2002b, Last and Stevens 2009). This sawfish may be the most tolerant of cooler waters, and as such has the most pole-ward distribution of all of the sawfish, at least in the southern hemisphere. For example, in Australian waters this species historically occurred as far south as Sydney on the east coast, while the limits of other species are much farther north. The Red Sea and Persian (Arabian) Gulf are regions of presumed historic abundance (M. McDavitt pers. comm. 2012, A. Moore pers. comm. 2012, R. Jabado pers. comm. 2012), as is the northwest of Australia (Morgan et al. 2011). Its current occurrence in much of this range is uncertain due to a lack of reliable data, but it is presumed to have been extirpated from much of this area because of intensive inshore gillnet and trawl fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa and Mauritius (Mascarenes) east to Philippines and New Guinea, north to South China Sea, south to New South Wales (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Red Sea and East Africa to Papua New Guinea, north to southern China, south to New South Wales, Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This once common sawfish has a wide distribution in the northern Indian Ocean, reaching east to South Africa, and is also found off Indonesia and Australia (1) (3) as well as in the western Pacific (7). Throughout this range, the populations of this species have been severely depleted and sightings have been rare in the last 40 years (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 7300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

730 cm TL (male/unsexed; (Ref. 5578))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inshore and intertidal to at least 5 m depth (Ref. 9859). Presumably used for human consumption in the Western central Pacific (Ref. 9859).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dark grey to blackish brown above, white to yellowish below (Ref. 11228).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Green Sawfish are most common in shallow water coastal and estuarine areas, but occur to depths to over 70 m (Stevens et al. 2005). A 3.5 m female tracked in the Gulf of Carpentaria (Australia) over a 27 hour period remained in shallow water (mean depth <1 m) and within 200 m of a mangrove shoreline (Peverell and Pillans 2004). Similarly, a 2.5 m male tracked in northwestern Australia showed similar movements, remaining in nearshore waters <1.5 m deep (Stevens et al. 2008). The young are known to use nearshore and estuarine areas as nurseries, and adults occur more broadly and into deeper areas as evidenced by the occurrence of large mature individuals in offshore trawl fisheries in northwestern Australia (Stephenson and Chidlow 2003).

Green Sawfish may be the largest of the sawfishes, with reports of individuals in excess of 7 m total length (TL). However, most reports suggest lengths over 6 m TL are currently rare. Mean size at birth in the Gulf of Carpentaria is 76 cm TL, and size at maturity at 340 to 380 cm TL (Peverell 2008, Last and Stevens 2009). Age and growth based on specimens from the Gulf of Carpentaria indicate that maturity is reached at about nine years, and maximum age may be >50 years (Peverell 2008). Little is known of reproductive biology. Reproduction is aplacental viviparous and litter size is about 12. Demographic models based on life history data from the Gulf of Carpentaria indicate that the generation time is 14.6 years, the intrinsic rate of population increase is very low (0.02 yr-1), and population doubling time is ~28 years (Moreno Iturria 2012).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; brackish; marine; depth range 0 - 5 m (Ref. 9859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 19.5 - 98
  Temperature range (°C): 24.821 - 27.959
  Nitrate (umol/L): 0.137 - 2.763
  Salinity (PPS): 34.382 - 35.439
  Oxygen (ml/l): 3.825 - 4.593
  Phosphate (umol/l): 0.078 - 0.341
  Silicate (umol/l): 2.972 - 6.693

Graphical representation

Depth range (m): 19.5 - 98

Temperature range (°C): 24.821 - 27.959

Nitrate (umol/L): 0.137 - 2.763

Salinity (PPS): 34.382 - 35.439

Oxygen (ml/l): 3.825 - 4.593

Phosphate (umol/l): 0.078 - 0.341

Silicate (umol/l): 2.972 - 6.693
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species inhabits muddy or sandy bottom habitats in inshore marine areas, intertidal areas and the lower parts of rivers (1) (6) (3). It can be found in lagoons, estuaries and shallow bays (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pristis zijsron

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTAATTTTTGGTGCTTGAGCAGGAATAGTTGGCACCGGCCTAAGCCTGCTTATTCGAACAGAGCTTAGCCAACCAGGGACACTTCTTGGAGATGACCAAATCTATAATGTAATTGTAACCGCCCACGCCTTTGTAATAATTTTCTTCATGGTAATACCAATTATAATCGGGGGCTTTGGTAACTGACTGGTTCCTCTAATAATTGGTGCCCCAGATATAGCATTTCCACGTATAAATAACATAAGTTTCTGATTACTACCCCCATCATTCCTCCTTCTACTAGCCTCTGCCGGAGTAGAGGCTGGAGCAGGAACAGGTTGAACTGTTTATCCTCCCCTCGCTGGTAACCTTGCTCATGCTGGAGCCTCTGTAGATCTAGCTATCTTTTCATTGCACTTAGCTGGTATCTCTTCCATCTTAGCATCCATTAATTTTATTACAACAATTATTAATATAAAACCCCCAGCAATCTCTCAATACCAAACACCCTTATTCGTGTGATCTATTCTTGTAACAACCATTCTTCTTTTACTTTCACTGCCTGTCCTAGCAGCAGGAATTACTATACTTCTTACAGATCGTAATCTAAACACAACCTTCTTTGACCCAGCAGGTGGAGGAGATCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pristis zijsron

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2013

Assessor/s
Simpfendorfer, C.

Reviewer/s
Böhm, M., Pillans, R. & Kyne, P.M.

Contributor/s

Justification

The Green Sawfish (Pristis zijsron) is probably the largest of the sawfish species, reaching lengths in excess of 7 m, although currently lengths greater than 6 m are rare. Historically, it occurred widely in the Indo-West Pacific from southern Africa to Australia and Taiwan, including the Red Sea, Persian (Arabian) Gulf and some of the Indian Ocean islands. The Green Sawfish is a coastal species, with the young occurring in shallow nearshore waters, while the adults are more common offshore in waters to >70 m. Its life history is poorly known, with data from the Gulf of Carpentaria (northern Australia) indicating that it has low intrinsic rates of population increase, making its resilience to fishing pressure low and its recovery from depletion slow. While the current population size and historic abundance is unknown, it is suspected as having declined in all of its range states. In Australian waters, its range has been well documented to have contracted significantly. Like all sawfishes, the toothed rostrum and demersal occurrence makes Green Sawfish extremely susceptible to capture in gillnets and demersal trawl nets. Historically, the population has been negatively affected by commercial net and trawl fisheries which operate in inshore areas throughout most of its range, the cumulative impacts of which have led to population declines. This species is now protected by no-take status in some range states (e.g. Australia, Bahrain, India), is listed on Appendix I of CITES, and is protected by some areas that are closed to fishing; but these actions alone will not be sufficient to ensure its survival in most regions. Despite a lack of quantitative data to support declines, available information indicates that populations of Green Sawfish are considerably rarer than historically across its entire range. Australia has some of the last remaining viable populations of Green Sawfish in the world, albeit at significantly reduced levels. Declines in the population are suspected to exceed 80% over three generation lengths (~44 yr), and it is possible that there has been localised extinction in a number of range states due to intensive fishing, reducing its extent of occurrence, and supporting its listing as Critically Endangered.


History
  • 2006
    Critically Endangered
  • 2000
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) by the IUCN Red List 2006 (1). Listed as an Endangered Species in New South Wales waters under the Fisheries Management Act 1994 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Data from northern Australia shows low to moderate levels of genetic diversity, with the lowest genetic diversity in the Gulf of Carpentaria. Populations in Western Australia and the Gulf of Carpentaria are distinct genetic stocks, with the remnant east coast population potentially also forming a distinct population (Phillips et al. 2011, Phillips 2012). Genetic data is not available for the remainder of the range, but given the Australian data the global population is likely to consist of a number of stocks.

There are very limited data available on the size and trend of the Green Sawfish population, either at the global or national scale. In Australian waters, all sawfish species have undergone significant, albeit largely unquantified, declines; the southern extent of the range of Green Sawfish on the Australian east coast has contracted from Sydney, New South Wales (NSW), to the Whitsunday region of Queensland (Harry et al. 2011). The last records from NSW were in 1972 (NSWDPI 2007) and in Moreton Bay (Queensland) in the 1960s (Johnson 1999). Extensive surveys of fish landing sites throughout Indonesia since 2001 have failed to observe this species (W. White pers. comm. 2012), suggesting that its occurrence in this region is now questionable. There is some evidence from the Persian (Arabian) Gulf (A. Moore pers. comm. 2012) and Red Sea (e.g. Sudan) of small but extant populations. The lack of data from surveys and fisheries in much of the remainder of its range suggests that the abundance of this species has declined significantly in most, if not all, areas, and is now at only a small fraction of its historic abundance. A population decline of >80% is suspected across the global range over the period of the last three generations.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Fishing is the primary threat to Green Sawfish. The large, toothed rostrum is easily entangled in fishing nets and other gear. In particular, inshore gillnet and trawl fisheries, which are common and intensive throughout much of the range of Green Sawfish, pose the greatest threat. Sawfishes are rarely targeted in these fisheries, but are regularly taken as retained bycatch because of the value of their fins, rostrum and meat. Data from specific fisheries is sparse, and rarely if ever to species level, making conclusions about the exact extent of the threats difficult to determine.

Data for northern Australia is probably the most comprehensive, and shows that gillnets were responsible for ~80% of records of sawfish captures (Stevens et al. 2005). The gillnet fisheries in northern Australia that are likely, or known, to interact with Green Sawfish include the Queensland East Coast Inshore Finfish Fishery (Harry et al. 2011), Gulf of Carpentaria Inshore Gillnet Fishery (Peverell 2005), Gulf of Carpentaria Offshore Gillnet Fishery (Peverell 2005), Northern Territory Barramundi Fishery (Field et al. 2008), Northern Territory Offshore Net and Line Fishery (Field et al. 2008), and the Kimberley Gillnet and Barramundi Fishery. Prawn trawl fisheries known, or suspected, to interact with Green Sawfish include the Northern Prawn Fishery, Queensland East Coast Trawl Fishery, and smaller prawn fisheries in Western Australia (e.g. Exmouth and Onslow) and New South Wales (NSW). The species is also known from fish trawl fisheries in northern Australia (Pilbara, Gulf of Carpentaria and Northern Territory). The take of Green Sawfish in recreational line fisheries is likely to occur at low levels, and recent education campaigns in Australia have aimed to reduce mortalities associated with these interactions. Outside of Australia the recent take of Green Sawfish in fisheries is poorly documented, partly because of its disappearance from many areas.

Ecological risk assessments of fisheries in northern Australia that interact with Green Sawfish have demonstrated that this species is one of the most at-risk elasmobranch species within the region. Its large size, low biological productivity, propensity for entanglement, and high value of products all contribute to this vulnerability (Salini et al. 2007, Tobin et al. 2010). Similar conclusions can be made for similar fisheries throughout its range. More detailed assessment of trawl data from Australia’s Northern Prawn Fishery indicated that the recent level of take was close to the sustainable limit (Zhou and Griffiths 2008), and when combined with the gillnet take in the same area, would undoubtedly be in excess of the level of sustainable take. As such, even in Australian waters, threats to this species are ongoing and populations are likely to continue to decline.

Green Sawfish are also taken in shark control programs in NSW, Queensland (Giles et al. 2004) and South Africa. The capture of Green Sawfish on all of these programs is now nonexistent (NSW and South Africa) or extremely rare (Queensland).

Other threats to Green Sawfish include habitat loss (particularly loss of intertidal areas, and coastal development), pollution, loss of genetic diversity and climate change. However, relative to fishing, these threats are unlikely to substantially affect global status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Critically Endangered (CR) (A2bcd+3cd+4bcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threat facing this species is accidental 'by-catch' by prawn fisheries, fish trawling, gillnetting and other fishing activities (4). Due to the saw and their large size, this species becomes entangled in nets very easily; as they are difficult to set free, they rarely survive becoming caught in this way (4). Direct fishing has also been a problem; this sawfish has been widely caught for its fins for use in the shark fin soup industry, its saw and for its flesh (4). The high price of the fins in Asian markets increase the threats facing all members of this family (3). Furthermore, degradation of the soft-bottomed habitats upon which they depend has been widespread (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Green Sawfish are fully protected in Australia by a variety of Federal (listed as Vulnerable, Environment Protection and Biodiversity Conservation Act 1999) and State legislation (Queensland, Protected [Fisheries Act 1994]; Northern Territory, Vulnerable [Territory Parks and Wildlife Conservation Act 2000]; Western Australia, Totally Protected [Fish Resources Management Act 1994]; New South Wales, Presumed Extinct). There are also a variety of specific fisheries regulations and reporting requirements in most Australian fisheries that interact with Green Sawfish. Sawfish are also protected in a number of range states, including India, Bahrain and Qatar. Although protected in these range states, the lack of enforcement or specific fisheries regulations, and ongoing gillnet and trawl fisheries, means that threats are ongoing.

The Green Sawfish is listed on Appendix I of the Convention on the International Trade in Endangered Species (CITES), prohibiting any international trade in the species. However, there is evidence that some Green Sawfish products (e.g., fins) remain in trade (M. McDavitt pers. comm. 2012).

The use of turtle exclusion devices (TEDs) is mandatory in some range states, though the benefit of these devices on sawfish is poorly quantified. In an Australian study they have been shown to reduce the catch of Narrow Sawfish (Anoxypristis cuspidata), however they and other sawfish species are still vulnerable to capture as their rostra become tangled in the body of the net (Brewer et al. 2006).

Marine protected areas within range states may also provide significant conservation benefit to Green Sawfish. Within Australian waters, areas closed to fishing include ~30% of the Great Barrier Reef Marine Park, and some estuaries and inshore waters of the Gulf of Carpentaria, Northern Territory and Western Australia. Temporal spawning closures for barramundi, the target species in inshore gillnet fisheries in northern Australia, also provide substantial protection (up to three months in some jurisdictions). In other range states, areas closed to fishing also occur. There are no closures specifically to address threats to Green Sawfish. The effectiveness of all areas closed to fishing throughout the range remain uncertain because of a lack of information about the movements of Green Sawfish.

Significant conservation benefits have been gained through education. In Australia, sawfish-specific handling guidelines have been developed and distributed to fishers in the form of printed material, videos and face-to-face training. This has aimed to maximise the survival of sawfish during release from fishing gear. Given the size and morphology of sawfish, releasing sawfish can be dangerous and historically they were often killed or de-sawed to make gear retrieval safer and easier. Thus development of handling guidelines (e.g., DEEDI 2010) may have significant benefit, and are also important for fisheries that operate in range states where they are fully protected (e.g., Australia). Conservation benefit may also be accrued from more general education of the public through display in public aquaria and through educational materials about sawfish such as outreach material provided to schools and other interested groups. However, to date such benefits have not been quantified. These activities increase awareness of the importance of these taxa and the conservation challenges that they face garnering public support for conservation actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

This species is classified as Critically Endangered on the IUCN Red List of Threatened Species (1). Current recovery actions include carrying out further research into the distribution and ecology of this sawfish, and encouraging its protection (4). It has been proposed that an Australian national recovery team should be established in order to set up and coordinate the recovery programme for this and other threatened sawfish (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Longcomb sawfish

The longcomb sawfish or green sawfish, Pristis zijsron, is a sawfish of the family Pristidae, found in tropical waters of the Indo-West Pacific oceans, from the Red Sea and east Africa to Papua New Guinea, north to southern China, and south to New South Wales, Australia, between latitudes 21° N and 37° S. This critically endangered species can reach a length of up to 7.3 metres (24 ft).[2]

Description[edit]

The longcomb sawfish has a shark-like body and an elongated, blade-like snout known as a rostrum that has triangular, saw-like teeth on either side. This is the largest sawfish in the genus Pristis and can reach as much as 7.3 metres (24 ft) long with a rostrum measuring 1.66 metres (5 ft 5 in). The dorsal (upper) surface is greenish-brown, the dorsal fins are yellowish-grey and the flanks are yellowish fading to a creamy-white colour on the ventral (under) surface. The rostral teeth are greyish-yellow and the central part of the rostrum is a darker shade. These teeth are slender and sharply pointed and usually number 23 to 37 pairs and this enables the longcomb sawfish to be distinguished from the otherwise similar knifetooth sawfish (Anoxypristis cuspidata) which has fewer rostral teeth, triangular in shape and blunt.[3]

Distribution and habitat[edit]

The longcomb sawfish is native to the western Indo-Pacific. Its range extends from the east coast of Africa, the Gulf of Aden and the Red Sea to India, Malaysia, Thailand, Indonesia and northern Australia. It is also known from southern China, Vietnam, the Philippines and Papua New Guinea. It is found in shallow marine habitats down to a depth of about 5 metres (16 ft) on sandy and muddy seabeds. It frequents estuaries and can enter rivers, an individual having once been found 150 miles (240 km) inland in the Northern Territory of Australia.[3]

Biology[edit]

The longcomb sawfish thrashes its rostrum from side-to-side to dislodge prey from the seabed and to stun fish. It is believed to feed on crustaceans, fish and squid. Little is known of its breeding habits but they are probably similar to the better studied largetooth sawfish (Pristis microdon) which produces a litter of live young after a gestation period of about five months and which gives birth in alternate years. It is known that longcomb sawfish pups measure about 60 to 108 centimetres (24 to 43 in) at birth.[3]

Status[edit]

The longcomb sawfish is listed by the IUCN as "Critically Endangered" in its Red List of Threatened Species. The population is believed to have declined by 80% over three generations, with the main threat being fishing. It is not usually the target species but easily gets entangled in fishing nets, and is retained as bycatch for its meat, fins and rostrum.[1]

See also[edit]

References[edit]

  1. ^ a b Simpfendorfer, C. (2013). "Pristis zijsron". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 26 August 2013. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Pristis zijsron" in FishBase. May 2006 version.
  3. ^ a b c "Green sawfish". Ichthyology. Florida Museum of Natural History. Retrieved 2013-09-24. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!