Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coral reefs. Commonly found on sand or rubble near coral heads. Frequently caught with S. variegatus and S. englemani, using artisanal gear and trawls. Sold fresh and dried salted in markets. Solitary,in pairs or in small groups (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Line, Marquesan, and Society islands, north to the Izu Islands (Japan), south to New South Wales (Australia); Palau to Kosrae in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Seychelles and Mauritius (Mascarenes) east to Marquesas Islands and Line Islands, north to Izu Islands (Japan) and Ogasawara Islands, south to Northwest Shelf (Western Australia), Chesterfield Islands and Loya
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 13; Analspines: 0; Analsoft rays: 8 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits shallow water. Common on sand or rubble near coral heads. Frequently caught with @S. variegatus@ and @S. englemani@, using artisanal gear and trawls. Sold fresh and dried salted in markets.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body brownish above, with dark brown saddle blotches; fins transparent, with faint brown spots on dorsal and caudal rays (Ref. 11228). Prominent black blotch on its caudal peduncle (Ref. 1602).Description: Characterized by snout with dendritic black spot on top; very short flap on anterior nostril (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Synodus jaculum Russell & Cressey
Catalog Number: USNM 217748
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Chan
Year Collected: 1964
Locality: South China Sea, Macclesfield Bank., Macclesfield Bank, South China Sea Islands, South China Sea, Pacific
Depth (m): 80 to 88
Vessel: Cape St. Mary
  • Paratype: Russell, B. C. & Cressey, R. F. 1979. Proceedings of the Biological Society of Washington. 92 (1): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Synodus jaculum Russell & Cressey
Catalog Number: USNM 217782
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Chan
Year Collected: 1964
Locality: South China Sea, Macclesfield Bank, Macclesfield Bank, South China Sea Islands, South China Sea, Pacific
Depth (m): 80.5 to 80.5
Vessel: Cape St. Mary
  • Paratype: Russell, B. C. & Cressey, R. F. 1979. Proceedings of the Biological Society of Washington. 92 (1): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Synodus jaculum Russell & Cressey
Catalog Number: USNM 217640
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Fehlmann, E. Raney, F. Talbot, R. Suttkus, J. Taylor, B. Rogers & A. Bakun
Year Collected: 1964
Locality: Indian Ocean: Comoro Islands, Mayotte Island, NE edge of Bandeli Reef. Outer edge of barrier reef., Mayotte, Comoro Islands, Bandeli Passage, Indian
Depth (m): 6
Vessel: Anton Bruun
  • Paratype: Russell, B. C. & Cressey, R. F. 1979. Proceedings of the Biological Society of Washington. 92 (1): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Synodus jaculum Russell & Cressey
Catalog Number: USNM 217794
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Bolin et al.
Year Collected: 1965
Locality: Christmas Island., Kiritimati (Christmas Island), Kiribati, Line Islands, Pacific
Depth (m): 3 to 4
Vessel: Te Vega
  • Paratype: Russell, B. C. & Cressey, R. F. 1979. Proceedings of the Biological Society of Washington. 92 (1): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Synodus jaculum Russell & Cressey
Catalog Number: USNM 217673
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Chan
Year Collected: 1974
Locality: S. China Sea, Macclesfield Bank, Macclesfield Bank, South China Sea Islands, South China Sea, Pacific
Depth (m): 82.31 to 84.13
Vessel: Cape St. Mary
  • Paratype: Russell, B. C. & Cressey, R. F. 1979. Proceedings of the Biological Society of Washington. 92 (1): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Synodus jaculum Russell & Cressey
Catalog Number: USNM 217621
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Roberts
Year Collected: 1970
Locality: Ceylon, Gulf of Mannar, southern and middle portions of Pearl Banks., Sri Lanka, Indian
Vessel: Pesalai
  • Paratype: Russell, B. C. & Cressey, R. F. 1979. Proceedings of the Biological Society of Washington. 92 (1): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 100 m (Ref. 11228)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0.75 - 119.5
  Temperature range (°C): 22.098 - 29.205
  Nitrate (umol/L): 0.025 - 9.015
  Salinity (PPS): 32.200 - 35.356
  Oxygen (ml/l): 3.284 - 4.812
  Phosphate (umol/l): 0.137 - 0.760
  Silicate (umol/l): 0.819 - 11.713

Graphical representation

Depth range (m): 0.75 - 119.5

Temperature range (°C): 22.098 - 29.205

Nitrate (umol/L): 0.025 - 9.015

Salinity (PPS): 32.200 - 35.356

Oxygen (ml/l): 3.284 - 4.812

Phosphate (umol/l): 0.137 - 0.760

Silicate (umol/l): 0.819 - 11.713
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 100m.
From 2 to 100 meters.

Habitat: reef-associated. Inhabits coral reefs. Commonly found on sand or rubble near coral heads. Frequently caught with @S. variegatus@ and @S. englemani@, using artisanal gear and trawls. Sold fresh and dried salted in markets.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Synodus jaculum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATATAATTTTTGGTGCCTGAGCCGGCATAGTCGGCACGGCCCTTAGCCTTTTAATTCGCGCAGAGCTTAGTCAGCCTGGCGCTCTTTTAGGCGATGACCAAATTTATAACGTAATCGTTACGGCTCATGCGTTTGTAATGATTTTTTTTATAGTAATACCTATCATGATTGGAGGGTTCGGGAACTGACTTATTCCCTTAATGATCGGCGCCCCGGACATGGCTTTTCCTCGGATAAACAATATAAGTTTCTGACTGCTTCCTCCATCATTTCTTTTACTCTTAGCATCTTCAGGTGTTGAGGCTGGTGCAGGGACTGGTTGAACAGTCTACCCCCCCTTGGCAGGCAACCTGGCCCACGCAGGGGCTTCAGTAGACTTAACAATTTTTTCCCTACATTTGGCCGGTATTTCTTCTATCCTAGGGGCAATCAATTTTATTACAACTATCATTAACATAAAACCCCCTTCGATTTCACAATACCAGACCCCTCTTTTCGTCTGAGCTGTACTAATCACAGCCGTTCTTCTTCTTCTATCCCTACCCGTATTAGCAGCCGGAATTACTATGCTTCTTACAGATCGAAATCTAAACACCACTTTTTTTGACCCCGCAGGAGGAGGTGACCCTATTTTATATCAGCACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Synodus jaculum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lighthouse lizardfish

The lighthouse lizardfish (Synodus jaculum) is a species of lizardfish that lives mainly in the Indo-Pacific.

Information[edit]

The lighthouse lizardfish is known to live in a marine environment within a depth range of about 2-100 meters. They are native to reef-associated locations within a tropical climate. The average length of the Synodus jaculum as an unsexed male is about 10 centimeters or 3.9 inches. The maximum recorded length of the Synodus jaculum as an unsexed male is about 20 centimeters or 7.87 inches. This species is identified by its brown colored body with the dark brown splotches. This species also has transparent fins. [1] The lighthouse lizardfish is native to the areas of Indo-Pacific, East Africa, Marquesan, Society islands, north to the Izu Islands in Japan, south to New South Wales in Australia, Palau, and Kosrae in Micronesia.[2] This species occupies coral reefs and it is found on sand or rubble near coral heads. This species of fish is caught and sold as fresh and salted in markets. [3] It is also common to find this species isolated, in pairs, or in small groups. [1]

Common names[edit]

The common names for the Synodus jaculum from different languages is as follows:

  • French : Anoli phare
  • English : Black-tailed lizardfish
  • English : Blackblotch lizardfish
  • English : Blacktail lizardfish
  • English : Javelinfish
  • Spanish : Lagarto faro
  • Japanese : Oguro-eso
  • Portuguese : Peixe-banana faroleiro[4]

Classification[edit]

The taxonomic classification of the Synodus jaculum is as follows:

  • Kingdom : Animalia
  • Phylum : Chordata
  • Class : Actinopterygii
  • Order : Aulopiformes
  • Family : Synodontidae
  • Genus : Synodus
  • Species : Synodus jaculum[5]

References[edit]

  1. ^ a b "Synodus jaculum Russell & Cressey, 1979 Lighthouse lizardfish". Fish Base. Retrieved 23 April 2013. 
  2. ^ "Lizardfishes, Family Synodontidae". Wet Web Media. Retrieved 23 April 2013. 
  3. ^ "Synodus jaculum — Overview Tailspot Lizardfish". Encyclopedia of Life. Retrieved 23 April 2013. 
  4. ^ "Lighthouse lizardfish". websiteofeverything.com. Retrieved 23 April 2013. 
  5. ^ "Synodus jaculum Russell, &. Cressey, 1979 TAILSPOT LIZARDFISH". Discover Life. Retrieved 23 April 2013. 

Notes[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!