Overview
Comprehensive Description
Biology
Found near prominent current-swept lagoons or seaward reefs (Ref. 9710). Also in bays and inner turbid lagoons (Ref. 9768). Nocturnally active, but occurring in relatively large schools during the day (Ref. 9768). Sold fresh or processed into fish cakes (Ref. 27550).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Distribution
Indo-West Pacific: Red Sea and East Africa to New Caledonia and Vanuatu, north to southern Japan. Reported from Fiji and Tuvalu (Ref. 12596).The exact range is uncertain because of confusion of this species with Sphyraena jello and Sphyraena qenie (Ref. 9768).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Mozambique, Somalia, South Africa (country)
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Red Sea, Indo-West Pacific: East Africa and Persian Gulf (Arabian Gulf) east to Fiji and Tuvalu, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Trusted
Physical Description
Morphology
Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 7 - 9
-
Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734
Trusted
Size
Max. size
90.0 cm TL (male/unsexed; (Ref. 2334))
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Diagnostic Description
Many typical chevron dark markings crossing lateral line on body; caudal fin largely blackish. No gill rakers on first arch, upper and lower gill arch with rough platelets, each platelet not bearing distinct spine.
-
Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range ? - 13 m (Ref. 58018)
-
Bogutskaya, N.G. 2007 Preliminary assignment of coordinates to type localities in the Catalog of Fishes. Unpublished dbf file. (Ref. 58018)
http://www.fishbase.org/references/FBRefSummary.php?id=58018&speccode=6010
Trusted
Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.
Environmental ranges
Depth range (m): 1 - 137
Temperature range (°C): 21.225 - 29.171
Nitrate (umol/L): 0.069 - 15.224
Salinity (PPS): 34.481 - 35.999
Oxygen (ml/l): 1.467 - 4.609
Phosphate (umol/l): 0.168 - 1.653
Silicate (umol/l): 1.043 - 16.843
Graphical representation
Depth range (m): 1 - 137
Temperature range (°C): 21.225 - 29.171
Nitrate (umol/L): 0.069 - 15.224
Salinity (PPS): 34.481 - 35.999
Oxygen (ml/l): 1.467 - 4.609
Phosphate (umol/l): 0.168 - 1.653
Silicate (umol/l): 1.043 - 16.843
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 46 samples.
Environmental ranges
Depth range (m): 1 - 137
Temperature range (°C): 21.225 - 29.171
Nitrate (umol/L): 0.069 - 15.224
Salinity (PPS): 34.481 - 35.999
Oxygen (ml/l): 1.467 - 4.609
Phosphate (umol/l): 0.168 - 1.653
Silicate (umol/l): 1.043 - 16.843
Graphical representation
Depth range (m): 1 - 137
Temperature range (°C): 21.225 - 29.171
Nitrate (umol/L): 0.069 - 15.224
Salinity (PPS): 34.481 - 35.999
Oxygen (ml/l): 1.467 - 4.609
Phosphate (umol/l): 0.168 - 1.653
Silicate (umol/l): 1.043 - 16.843
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Found near prominent current-swept lagoon or seaward reefs (Ref. 9710). Also in bays and inner turbid lagoons (Ref. 9768). Nocturnally active, but occurring in relatively large schools during the day (Ref. 9768).
-
Thollot, P. 1996 Les poissons de mangrove du lagon sud-ouest de Nouvelle-Calédonie. ORSTOM Éditions, Paris. (Ref. 11889)
http://www.fishbase.org/references/FBRefSummary.php?id=11889&speccode=555
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sphyraena putnamae
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 15 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 15 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTACCTACTATTTGGCGCCTGGGCTGGGATGGTAGGTACAGCTCTAAGCCTACTTATTCGAGCCGAACTTAGTCAACCGGGCTCTCTCTTAGGAGACGACCAAATTTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCCATTATGATTGGGGGCTTTGGGAACTGACTTATTCCCCTAATAATTGGCGCTCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTTTGACTACTCCCCCCTTCCTTTCTCTTACTCCTTTCTTCTTCGGCTGTAGAAGCGGGAGCCGGGACAGGATGGACAGTTTATCCTCCCTTAGCTGGAAATTTGGCCCATGCAGGAGCATCCGTCGACCTAACCATTTTCTCCCTTCACCTGGCAGGTATTTCTTCAATCCTAGGGGCTATTAATTTTATTACCACTATTATTAACATGAAACCAGCGGCGACTTCAATGTACCAAATTCCTCTGTTCGTTTGGGCTGTACTAATCACTGCCGTTCTCCTTCTCCTTTCACTCCCTGTCTTAGCTGCTGGTATTACAATGCTCTTGACAGATCGAAATCTAAACACCGCCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTGTACCAGCACTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sphyraena putnamae
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 33
Species With Barcodes: 1
Public Records: 10
Specimens with Barcodes: 33
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; gamefish: yes
-
Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
http://www.fishbase.org/references/FBRefSummary.php?id=4537&speccode=1255
-
Bianchi, G. 1985 FAO species identification sheets for fishery purposes. Field guide to the commercial marine and brackish-water species of Pakistan. Prepared with the support of PAK/77/033 and FAO (FIRM) Regular Programme. Rome: FAO. 200 p. (Ref. 2872)
http://www.fishbase.org/references/FBRefSummary.php?id=2872&speccode=363
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


