Overview

Comprehensive Description

Biology

Found near prominent current-swept lagoons or seaward reefs (Ref. 9710). Also in bays and inner turbid lagoons (Ref. 9768). Nocturnally active, but occurring in relatively large schools during the day (Ref. 9768). Sold fresh or processed into fish cakes (Ref. 27550).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to New Caledonia and Vanuatu, north to southern Japan. Reported from Fiji and Tuvalu (Ref. 12596).The exact range is uncertain because of confusion of this species with Sphyraena jello and Sphyraena qenie (Ref. 9768).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa and Persian Gulf (Arabian Gulf) east to Fiji and Tuvalu, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 7 - 9
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)   http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

90.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Many typical chevron dark markings crossing lateral line on body; caudal fin largely blackish. No gill rakers on first arch, upper and lower gill arch with rough platelets, each platelet not bearing distinct spine.
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)   http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 13 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.

Environmental ranges
  Depth range (m): 1 - 137
  Temperature range (°C): 21.225 - 29.171
  Nitrate (umol/L): 0.069 - 15.224
  Salinity (PPS): 34.481 - 35.999
  Oxygen (ml/l): 1.467 - 4.609
  Phosphate (umol/l): 0.168 - 1.653
  Silicate (umol/l): 1.043 - 16.843

Graphical representation

Depth range (m): 1 - 137

Temperature range (°C): 21.225 - 29.171

Nitrate (umol/L): 0.069 - 15.224

Salinity (PPS): 34.481 - 35.999

Oxygen (ml/l): 1.467 - 4.609

Phosphate (umol/l): 0.168 - 1.653

Silicate (umol/l): 1.043 - 16.843
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found near prominent current-swept lagoon or seaward reefs (Ref. 9710). Also in bays and inner turbid lagoons (Ref. 9768). Nocturnally active, but occurring in relatively large schools during the day (Ref. 9768).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena putnamae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTACTATTTGGCGCCTGGGCTGGGATGGTAGGTACAGCTCTAAGCCTACTTATTCGAGCCGAACTTAGTCAACCGGGCTCTCTCTTAGGAGACGACCAAATTTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCCATTATGATTGGGGGCTTTGGGAACTGACTTATTCCCCTAATAATTGGCGCTCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTTTGACTACTCCCCCCTTCCTTTCTCTTACTCCTTTCTTCTTCGGCTGTAGAAGCGGGAGCCGGGACAGGATGGACAGTTTATCCTCCCTTAGCTGGAAATTTGGCCCATGCAGGAGCATCCGTCGACCTAACCATTTTCTCCCTTCACCTGGCAGGTATTTCTTCAATCCTAGGGGCTATTAATTTTATTACCACTATTATTAACATGAAACCAGCGGCGACTTCAATGTACCAAATTCCTCTGTTCGTTTGGGCTGTACTAATCACTGCCGTTCTCCTTCTCCTTTCACTCCCTGTCTTAGCTGCTGGTATTACAATGCTCTTGACAGATCGAAATCTAAACACCGCCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTGTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena putnamae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!