Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found near prominent current-swept lagoons or seaward reefs (Ref. 9710). Also in bays and inner turbid lagoons (Ref. 9768). Nocturnally active, but occurring in relatively large schools during the day (Ref. 9768). Sold fresh or processed into fish cakes (Ref. 27550).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to New Caledonia and Vanuatu, north to southern Japan. Reported from Fiji and Tuvalu (Ref. 12596).The exact range is uncertain because of confusion of this species with Sphyraena jello and Sphyraena qenie (Ref. 9768).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa and Persian Gulf (Arabian Gulf) east to Fiji and Tuvalu, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 7 - 9
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

90.0 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Many typical chevron dark markings crossing lateral line on body; caudal fin largely blackish. No gill rakers on first arch, upper and lower gill arch with rough platelets, each platelet not bearing distinct spine.Description: Characterized further by having close-set teeth, those in lower jaw angled backward; corner of preopercle lacking membranous flap; maxilla reaching below anterior edge of eye; moderate eye size; first dorsal origin over tip of pectoral fins and below or slightly behind base of pelvic fins; deeply forked caudal fin without inner lobes; depth of body 6.9-8.5 in SL (Ref. 90102).
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 20 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.

Environmental ranges
  Depth range (m): 1 - 137
  Temperature range (°C): 21.225 - 29.171
  Nitrate (umol/L): 0.069 - 15.224
  Salinity (PPS): 34.481 - 35.999
  Oxygen (ml/l): 1.467 - 4.609
  Phosphate (umol/l): 0.168 - 1.653
  Silicate (umol/l): 1.043 - 16.843

Graphical representation

Depth range (m): 1 - 137

Temperature range (°C): 21.225 - 29.171

Nitrate (umol/L): 0.069 - 15.224

Salinity (PPS): 34.481 - 35.999

Oxygen (ml/l): 1.467 - 4.609

Phosphate (umol/l): 0.168 - 1.653

Silicate (umol/l): 1.043 - 16.843
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found near prominent current-swept lagoon or seaward reefs (Ref. 9710). Also in bays and inner turbid lagoons (Ref. 9768). Nocturnally active, but occurring in relatively large schools during the day (Ref. 9768).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena putnamae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTACTATTTGGCGCCTGGGCTGGGATGGTAGGTACAGCTCTAAGCCTACTTATTCGAGCCGAACTTAGTCAACCGGGCTCTCTCTTAGGAGACGACCAAATTTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCCATTATGATTGGGGGCTTTGGGAACTGACTTATTCCCCTAATAATTGGCGCTCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTTTGACTACTCCCCCCTTCCTTTCTCTTACTCCTTTCTTCTTCGGCTGTAGAAGCGGGAGCCGGGACAGGATGGACAGTTTATCCTCCCTTAGCTGGAAATTTGGCCCATGCAGGAGCATCCGTCGACCTAACCATTTTCTCCCTTCACCTGGCAGGTATTTCTTCAATCCTAGGGGCTATTAATTTTATTACCACTATTATTAACATGAAACCAGCGGCGACTTCAATGTACCAAATTCCTCTGTTCGTTTGGGCTGTACTAATCACTGCCGTTCTCCTTCTCCTTTCACTCCCTGTCTTAGCTGCTGGTATTACAATGCTCTTGACAGATCGAAATCTAAACACCGCCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTGTACCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena putnamae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
  • Bianchi, G. 1985 FAO species identification sheets for fishery purposes. Field guide to the commercial marine and brackish-water species of Pakistan. Prepared with the support of PAK/77/033 and FAO (FIRM) Regular Programme. Rome: FAO. 200 p. (Ref. 2872)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!