Overview

Comprehensive Description

Biology

Benthopelagic over reefs and rocks (Ref. 58302). Feed mainly on coral polyps, also polychaete worms and small shrimps. Usually seen in pairs. Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: Hawaiian Islands and Johnston Atoll.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Hawaiian Islands and Johnston Atoll (Burgess 1978, G.R. Allen pers. comm. 2006). It generally occurs between five and 30 m depth, but may occur at depths up to 114 m (Chave and Mundy 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 23 - 26; Analspines: 3; Analsoft rays: 18 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 120 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 5 - 114 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Chaetodon multicinctus is an obligate corallivore that shows a strong preference for the coral Pocillopora meandrina (Tricas 1989b, Cox 1994), is territorial (Tricas 1989a) and is a monogamous pair spawner (Reese 1975) with an elaborate courtship behaviour (Lobel 1989a) observed from March to July (Lobel 1989b, Tricas and Hiramoto 1989). Tricas and Hiramoto (1989) report the onset of reproductive maturity for male C. multicintus at 62 mm, and for females at 44 mm corresponding to less than one year for both sexes (Tricas 1986).

Lagoon and seaward reef areas with prolific coral growth (particularly Porites and Pocillopora). Frequently observed in pairs or small aggregations (Allen 1980). Juveniles present on shallow inshore reefs from April to September (G.R. Allen pers. comm. 2006).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 30m.
From 5 to 30 meters.

Habitat: reef-associated. Feeds mainly on coral polyps, also polychaete worms and small shrimps. Usually seen in pairs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feed mainly on coral polyps, also polychaete worms and small shrimps. Usually seen in pairs. Tend to have protruding snout and teeth that project from small mouth which permit them to snip off scleractinian coral polyps despite the surrounding calcareous armor (Ref. 59308).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon multicinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTCGGTGCTTGAGCTGGAATAGTGGNCACCGCTTTAAGTCTACTTATCCGAGCAGAGCTCAGTCAACCAGGCAGTCTTCTAGGCGACGATCAAATCTATAATGTAATCGTTACGGCGCATGCATTCGTGATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTGATTCCTCTAATGATTGGAGCCCCTGATATGGCCTTCCCTCGTATGAATAACATGAGCTTTTGACTCCTGCCCCCTTCCTTCTTCCTCCTTCTTGCCTCTTCTGGTGTAGAGTCTGGGGCTGGCACTGGATGAACAGTTTATCCGCCACTGGCCGGCAATCTGGCACATGCCGGAGCATCTGTTGATCTAACCATCTTCTCCCTTCACCTTGCAGGGATTTCCTCTATTCTTGGGGCCATTAACTTCATCACAACGATCCTCAATATGAAACCCCCCGCCATATCTCAATATCAAACCCCTCTCTTCGTATGATCCGTCCTAATTACAGCTGTCCTTCTTCTTCTATCACTTCCTGTTCTTGCAGCCGGGATTACAATGCTCCTAACAGATCGAAATCTAAACACAACCTTTTTTGATCCGGCGGGAGGCGGCGACCCGATTCTGTACCAACATTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon multicinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Craig, M.T. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Chaetodon multicinctus is an abundant species throughout its range and there are no major threats identified for this species. Two thirds of its range are enclosed by the Papahanaumokuakea Marine National Monument, a no-take marine reserve. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

It is generally very common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

This species relies on live coral for food and/or recruitment, and may therefore decline in abundance following climate-induced coral depletion. Currently there has been no documented declines associated with coral loss, and there appear to be no other major threats to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation measures for Chaeotodon multicinctus. It occurs in protected areas (e.g., the Papahānaumokuākea Marine National Monument encloses nearly 2/3 of the species' range). Monitoring of this species is needed in conjunction with coral monitoring.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pebbled butterflyfish

Pebbled butterflyfish (Chaetodon multicinctus) are marine, perciform fish often found near reefs. They are at most 12 centimetres (4.7 in) in length, and white with yellow, brown, and black markings. These butterflyfish are territorial and form pairs. The pebbled butterflyfish occur near reefs in the eastern central Pacific, and are endemic to waters off the Hawaiian Islands and Johnston Atoll. They have a role in aquarium trade.[1]

Description and biology

Pebbled butterflyfish reach maximum lengths of 12 centimetres (4.7 in).[1] The body is spotted and white, though it may bear shades of green and yellow. There are five light brown bands crossing the side of the body. On the ventral side, a dark line extends from the anal fins, gradually lightening to yellow as it moves towards the pelvic fins.[2] Though often mistaken for the crochet butterflyfish (Chaetodon guentheri) or speckled butterflyfish (Chaetodon citrinellus), the pebbled butterflyfish can be distinguished by its vertical bands.[3]

On the dorsal and anal fins, there is a black line running lengthwise, approximately one-third the total height of the fin from the outer margin.[2] The pelvic fins are white, and the pectorals are transparent. The caudal fin bears a black crescent at its middle and a dark ring at its base.[2]

They form pairs, especially for breeding, and lay eggs.[1] Pebbled butterflyfish are monogamous and are aggressively territorial. They will mate to defend a feeding territory.[4] The diet of the pebbled butterflyfish is fairly specialist,[5] and is cromprised of coral polyps, polychaete worms, and small shrimps.[1]

Distribution and habitat

Pebbled butterflyfish are distributed throughout the eastern central Pacific Ocean. They are found in waters off the Hawaiian Islands and Johnston Atoll. Pebbled butterflyfish occur near coral reefs and over rocks.[1]

References

  1. ^ a b c d e Froese, Rainer, and Daniel Pauly, eds. (2010). "Chaetodon multicinctus" in FishBase. January 2010 version.
  2. ^ a b c Jenkins, Oliver P. (1904). "Report on Collections of Fishes made in the Hawaiian Islands, with Descriptions of New Species". Bulletin of the United States Fish Commission (Washington: The Commission, Government Printing Office) 22: 472. 
  3. ^ Goodson, Gar (1986). "1". The many-splendored fishes of Hawaii. Stanford: Stanford University Press. p. 5. ISBN 978-0-8047-1270-5. 
  4. ^ Dewan, A. K.; K. P. Maruska and T. C. Tricas (2008). "Arginine Vasotocin Neuronal Phenotypes among Congeneric Territorial and Shoaling Reef Butterflyfishes: Species, Sex and Reproductive Season Comparisons". Journal of Neuroendocrinology (Blackwell Publishing) 20: 1382–1394. doi:10.1111/j.1365-2826.2008.01798.x. Retrieved 11 April 2010. 
  5. ^ Ludwig, G. M.; L. R. Taylor Jr., and D. M. Imose (August 1980). "Summer Census of the Reef-Fish Community of Waters Adjacent to Pu'uhonua o Honaunau National Historical Park". Technical Report 32. Honolulu: University of Hawaii. Retrieved 11 April 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!