Overview

Comprehensive Description

Biology

Adults inhabit lagoon and seaward reefs, usually deeper than 20 m to at least 42 m (Ref. 9710). Juveniles are solitary and adults form small groups, each with several females and a dominant male (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Minimum depth reported from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found from the Red Sea down the east coast of Africa, Madagascar, Maldives and Laccadives and possibly presence in Andaman and Nicobar Islands needs clarification. Records from most of South East Asia probably refer to A. melanurus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea south to Natal, South Africa (Ref. 4392) and east to Bali, Indonesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Western Indian Ocean: East Africa and Natal (South Africa), Seychelles and Mascarenes east to Maldives.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 11441))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body orange-brown, with pale longitudinal blue-green lines following scale rows; head with irregular light blue-green lines; opercular flap with a black spot; caudal fin white with a broad black bar on posterior part of fin (Ref. 4392). Red Sea form is slightly different. Females are distinguished by the white versus yellow band on the base of the tail and males by the lined versus spotted pattern on the body (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Anampses melanurus lineatus Randall
Catalog Number: USNM 208027
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1972
Locality: Elat, Gulf of Aqaba, Red Sea Off Heinz Steinitz Marine Biology Lab., Eilat, Israel, Gulf of Aqaba, Red Sea, Indian
Depth (m): 43 to 43
  • Paratype: Randall, J. E. 1972. Micronesica. 8 (1-2): 172.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits coral reefs – lagoon and seaward reefs usually deeper than 20 m to at least 42 m.

Juveniles are solitary and adults form small groups, each with several females and a dominant male.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 10 - 42 m (Ref. 9710), usually 20 - 42 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 7.5 - 45

Graphical representation

Depth range (m): 7.5 - 45
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 42m.
From 10 to 42 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anampses lineatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGCGCCTGAGCCGGGATGGTGGGTACAGCTTTAAGCTTACTTATTCGAGCTGAACTAAGCCAGCCCGGTGCTCTCCTTGGAGACGACCAGATTTACAATGTTATCGTTACAGCCCATGCATTCGTAATAATCTTCTTTATAGTAATGCCAATTATAATCGGTGGATTCGGGAATTGACTCATTCCATTAATAATTGGGGCACCAGATATAGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTCCTACCCCCCTCTTTCTTACTCCTTCTTGCTTCTTCCGGTGTAGAAGCTGGAGCCGGGACTGGTTGAACAGTTTACCCTCCTCTAGCAGGAAACCTCGCCCATGCAGGTGCATCTGTCGATTTAACTATCTTCTCCCTACACTTAGCCGGCATTTCTTCAATCTTGGGTGCTATCAACTTTATTACAACTATTATTAACATAAAACCTCCTGCTATCTCTCAATATCAAACCCCTCTTTTCGTCTGAGCTGTACTAATCACGGCAGTACTTCTTCTTCTCTCCCTACCTGTTCTAGCAGCTGGAATTACAATGCTTCTAACAGATCGTAATCTAAACACTACCTTTTTCGACCCTGCCGGAGGCGGGGACCCCATTCTCTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anampses lineatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A.

Reviewer/s
Liu, M. & Carpenter, K.E.

Contributor/s

Justification
The distribution of this species is unclear due to confusion with A. melanurus. This species is collected for the aquarium trade, although the impact of this threat on its population is unknown. It is therefore listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information for this species. The population status is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is exploited for the aquarium industry. Habitat degredation on coral reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures in place for this species. However, its distribution overlaps some marine protected areas within is range. Research needs include clarification on the distribution of the two species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Anampses lineatus

The lined wrasse, Anampses lineatus, is a species of wrasse native to the Indo-Pacific from the Red Sea to South Africa east to Bali. This species can be found at depths from 10 to 45 m (33 to 148 ft) (though usually below 20 m (66 ft)) in lagoons and on reefs. It can reach a length of 13 cm (5.1 in). It can be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. 2010. Anampses lineatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 30 October 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Anampses lineatus" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!