Overview

Comprehensive Description

Biology

Found in outer reef habitats. Adults usually occurs in pairs (Ref. 48636). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indian Ocean from the East African coast and Madagascar, to Sri Lanka, Cocos-Keeling Islands, Christmas Island, and western Sumatra, including all oceanic islands in between (Allen 1980). Found at depths from 8-60 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian Ocean: East Africa (Ref. 12484), including Port Elizabeth, South Africa to the Cocos-Keeling and Christmas islands, north to Sri Lanka.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian Ocean: South Africa, East Africa, Seychelles, Madagascar and Mascarenes east to Cocos-Keeling and Christmas islands (eastern Indian Ocean), north to Sri Lanka.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 18 - 20; Analspines: 3; Analsoft rays: 15 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 5372))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Easily identified by the orange markings and 5-6 chevron shaped lines on the body (Ref. 48636). Snout length 2.7-3.2 in HL. Body depth 1.7-1.8 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Rocky or coral-covered reefs of lagoons and outer slopes (frequently seen adjacent to steep slopes and drop-offs), from 8-60 m. Feeds on algae and benthic invertebrates (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2.5 - 30
  Temperature range (°C): 27.048 - 27.360
  Nitrate (umol/L): 0.048 - 0.076
  Salinity (PPS): 34.960 - 35.029
  Oxygen (ml/l): 4.664 - 4.698
  Phosphate (umol/l): 0.169 - 0.178
  Silicate (umol/l): 3.311 - 3.715

Graphical representation

Depth range (m): 2.5 - 30

Temperature range (°C): 27.048 - 27.360

Nitrate (umol/L): 0.048 - 0.076

Salinity (PPS): 34.960 - 35.029

Oxygen (ml/l): 4.664 - 4.698

Phosphate (umol/l): 0.169 - 0.178

Silicate (umol/l): 3.311 - 3.715
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 10 - 120 m (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2.5 - 30
  Temperature range (°C): 27.048 - 27.360
  Nitrate (umol/L): 0.048 - 0.076
  Salinity (PPS): 34.960 - 35.029
  Oxygen (ml/l): 4.664 - 4.698
  Phosphate (umol/l): 0.169 - 0.178
  Silicate (umol/l): 3.311 - 3.715

Graphical representation

Depth range (m): 2.5 - 30

Temperature range (°C): 27.048 - 27.360

Nitrate (umol/L): 0.048 - 0.076

Salinity (PPS): 34.960 - 35.029

Oxygen (ml/l): 4.664 - 4.698

Phosphate (umol/l): 0.169 - 0.178

Silicate (umol/l): 3.311 - 3.715
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 40m.
From 10 to 40 meters.

Habitat: reef-associated. Pearly butterflyfish.  Ahl, 1923 Attains 13 cm. Indian Ocean from the east coast of Africa to Christmas Island, Madagascar, Mauritius south to Port Elizabeth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Among coral reefs (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon madagaskariensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGTGCTTGAGCTGGTATAGTGGGCACCGCTTTAAGTCTACTTATCCGAGCAGAGCTCAGTCAACCAGGCTCCCTTCTAGGCGACGATCAGATCTATAATGTAATCGTTACGGCACATGCGTTCGTGATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTAATTCCTCTAATGATTGGGGCCCCTGATATAGCCTTCCCTCGCATGAACAACATGAGCTTTTGACTTCTGCCCCCTTCCTTCTTCCTACTACTTGCCTCTTCAGGCGTAGAATCTGGGGCCGGTACCGGGTGAACGGTATATCCCCCGTTAGCCGGTAACCTGGCACACGCCGGAGCGTCCGTTGATCTTACCATCTTCTCCCTCCACCTCGCTGGGATTTCCTCTATTCTTGGGGCCATCAATTTCATCACAACCATCCTCAATATGAAACCCCCCGCTATGTCCCAGTATCAAACCCCCCTCTTCGTATGATCCGTTCTAATTACAGCTGTTCTGCTTCTTCTGTCCCTTCCTGTTCTTGCAGCCGGAATTACAATACTCCTAACAGACCGAAACTTAAACACAACCTTCTTCGACCCAGCAGGAGGTGGCGACCCAATTCTGTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon madagaskariensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Chaetodon madagaskariensis is a widespread and common species. There are no major threats for this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is considered common in many parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection is limited and is not considered to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is believed to be present within a number of marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Seychelles butterflyfish

The Seychelles Butterflyfish, Chaetodon madagaskariensis, is a species of butterflyfish (family Chaetodontidae). It is found in the Indian Ocean from eastern Africa (as far south as Port Elizabeth in South Africa) east to Cocos-Keeling Islands and Christmas Island, north to Sri Lanka. The Seychelles Butterflyfish is found in areas of rich coral growth on seaward reefs, at 10-40 m depth.[2]

It grows to a maximum of 13 cm (more than 5 in) long. The body color is silver at the head, becoming white towards the tail, with a triangular orange patch covering the posterior and the caudal peduncle. There are a series of dark grey chevron lines on the sides of the body, partly broken into spots. Between the eyes and the start of the dorsal fin there is a black patch rimmed with white. The base of the caudal fin is white, followed by an orange patch and a white rim.[2]

Systematics[edit source | edit]

C. madagaskariensis is one of the "crowned" butterflyfishes. These form a group of largely allopatric species sharing the overall color pattern of dark forward-pointing chevrons on silvery hues, (usually) a black-and-white crown spot and yellow to red hindparts to a stunning degree; they differ in the exact combination of hues and some small pattern details. Other members of this lineage are the closely related Eritrean (C. paucifasciatus) and Atoll Butterflyfishes (C. mertensii), and the more distant Pearlscale Butterflyfish (C. xanthurus).[3]

The "crowned" Chaetodon are a clearly recognizable clade, but their further relationships are otherwise less clear. They were often placed in the subgenus Exornator, or considered a distinct subgenus Rhombochaetodon. According to various DNA sequence studies, some older and more singular lineages. These include species such as the Asian Butterflyfish (C. argentatus), the Blue-striped Butterflyfish (C. fremblii) and Burgess' Butterflyfish (C. burgessi). C. burgessi is in fact so peculiar that it was placed in a monotypic subgenus Roaops. But recognition of this would probably result in several other small or monotypic subgenera becoming justified, and the older Rhombochaetodon would be the more conveniently apply to the entire radiation.[3]

But the expanded group is of unclear relationships to species like the Speckled Butterflyfish (C. citrinellus) and the Four-spotted Butterflyfish (C. quadrimaculatus). These might be members of the subgenus Exornator – the lineages around the Spot-banded Butterflyfish (C. punctatofasciatus) – and C. citrinellus certainly looks somewhat similar to these. Yet phylogenetically, their position towards Rhombochaetodon is unresolved, and ultimately it might be better to merge both Rhombochaetodon and Roaops in Exornator. If the genus Chaetodon is split up, Exornator might become a subgenus of Lepidochaetodon or a separate genus.[3]

Footnotes[edit source | edit]

  1. ^ Myers, R. & Pratchett, M. 2010. Chaetodon madagaskariensis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ a b FishBase (2008)
  3. ^ a b c Fessler & Westneat (2007), Hsu et al. (2007)

References[edit source | edit]

  • Fessler, Jennifer L. & Westneat, Mark W. (2007): Molecular phylogenetics of the butterflyfishes (Chaetodontidae): Taxonomy and biogeography of a global coral reef fish family. Mol. Phylogenet. Evol. 45(1): 50–68. doi:10.1016/j.ympev.2007.05.018 (HTML abstract)
  • FishBase (2008): Chaetodon madagaskariensis. Version of 2008-JAN-14. Retrieved 2008-SEP-01.
  • Hsu, Kui-Ching; Chen, Jeng-Ping & Shao, Kwang-Tsao (2007): Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups. Raffles Bulletin of Zoology Supplement 14: 77-86. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!