Overview

Comprehensive Description

Biology

Associated with colonies of broadly branched corals (Acropora spp.) (Ref. 35408); a coral-commensal species (Ref. 72446). Produces toxic mucus (Ref. 9360, 48637).Has been reared in captivity (Ref. 35408). Solitary or in pairs (Ref 90102).
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea south to Delagoa Bay, Mozambique and east to Samoa, north to southern Japan, south to the Great Barrier Reef.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Aldabra, Seychelles and Réunion (western Mascarenes) east to Samoa and Tonga, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9 - 11; Analspines: 1; Analsoft rays: 9
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 66 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.6 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Associated with colonies of broadly branched corals (@Acropora@ spp.).<111>. Species of the genus Gobiodon produce much mucus which contains a toxin; the mucus has a strong bitter taste<307>.
  • Froese, R. & D. Pauly (Editors). (2014). FishBase. World Wide Web electronic publication.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characterized by having variable body color from yellow to yellowish green or black; presence of pair of blue bars through eye, second pair across back of head; blue stripe along base of dorsal fin; upper pectoral base with small dark spot (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 12 m (Ref. 90102), usually 2 - 20 m (Ref. 27115)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 1.525 - 12
  Temperature range (°C): 22.368 - 28.941
  Nitrate (umol/L): 0.047 - 0.622
  Salinity (PPS): 32.279 - 35.552
  Oxygen (ml/l): 4.484 - 5.079
  Phosphate (umol/l): 0.055 - 0.327
  Silicate (umol/l): 0.910 - 4.452

Graphical representation

Depth range (m): 1.525 - 12

Temperature range (°C): 22.368 - 28.941

Nitrate (umol/L): 0.047 - 0.622

Salinity (PPS): 32.279 - 35.552

Oxygen (ml/l): 4.484 - 5.079

Phosphate (umol/l): 0.055 - 0.327

Silicate (umol/l): 0.910 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon citrinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTCTACTTGGTCTTTGGTGCCTGGGCCGGGATAGTAGGGACTGCTCTAAGCCTGCTCATTCGAGCCGAGCTGAGCCAACCTGGGGCACTACTTGGAGACGACCAGGTCTATAACGTAATTGTTACTGCGCACGCCTTTGTGATGATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGGAATTGACTAATTCCCCTGATGATTGGCGCCCCCGACATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGGCTCCTCCCTCCCTCTTTTCTTCTCTTGCTGGCATCCTCGGGCGTCGAAGCGGGGGCAGGGACGGGATGAACGGTGTACCCTCCACTAGCCGGCAACCTTGCACACGCCGGAGCATCCGTTGACCTAACCATCTTCTCTCTCCACCTTGCAGGCATCTCTTCTATCCTCGGAGCAATTAACTTCATTACTACCATCCTTAACATAAAACCCCCTGCCGTCTCTCAGTATCAAACACCCTTGTTCGTCTGAGCTGTGCTAATCACGGCTGTACTGTTGCTGCTCTCTCTCCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGACCGAAACCTTAACACAACCTTCTTTGACCCTGCAGGGGGAGGAGACCCCATTCTCTATCAGCACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon citrinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Edwards, A.J. and A.D. Shepherd 1992 Environmental implications of aquarium-fish collection in the Maldives, with proposals for regulation. Environ. Conserv. 19:61-72. (Ref. 4907)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gobiodon citrinus

Gobiodon citrinus, the Poison Goby, is a species of goby native to the Indian Ocean from the Red Sea and the coast of Africa to the western Pacific Ocean to Japan, Samoa and the Great Barrier Reef. They are reef dwellers being found at depths of from 2 to 20 metres (6.6 to 65.6 ft) and in association with Acropora corals. The mucus produced by this fish is toxic. They grow to a length of 6.6 centimetres (2.6 in) TL. They have varied body colour and could be either dark brown, or pale yellow. They also have blue vertical lines that go around their eyes and gills. This species is also found in the aquarium trade and has been reared in the aquarium.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!