Overview

Comprehensive Description

Biology

Associated with colonies of broadly branched corals (Acropora spp.) (Ref. 35408); a coral-commensal species (Ref. 72446). Produces toxic mucus (Ref. 9360, 48637).Has been reared in captivity (Ref. 35408).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea south to Delagoa Bay, Mozambique and east to Samoa, north to southern Japan, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Aldabra, Seychelles and Réunion (western Mascarenes) east to Samoa and Tonga, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9 - 11; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 66 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.6 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Associated with colonies of broadly branched corals (@Acropora@ spp.).<111>. Species of the genus Gobiodon produce much mucus which contains a toxin; the mucus has a strong bitter taste<307>.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine, usually 2 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 1.525 - 12
  Temperature range (°C): 22.368 - 28.941
  Nitrate (umol/L): 0.047 - 0.622
  Salinity (PPS): 32.279 - 35.552
  Oxygen (ml/l): 4.484 - 5.079
  Phosphate (umol/l): 0.055 - 0.327
  Silicate (umol/l): 0.910 - 4.452

Graphical representation

Depth range (m): 1.525 - 12

Temperature range (°C): 22.368 - 28.941

Nitrate (umol/L): 0.047 - 0.622

Salinity (PPS): 32.279 - 35.552

Oxygen (ml/l): 4.484 - 5.079

Phosphate (umol/l): 0.055 - 0.327

Silicate (umol/l): 0.910 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon citrinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTCTACTTGGTCTTTGGTGCCTGGGCCGGGATAGTAGGGACTGCTCTAAGCCTGCTCATTCGAGCCGAGCTGAGCCAACCTGGGGCACTACTTGGAGACGACCAGGTCTATAACGTAATTGTTACTGCGCACGCCTTTGTGATGATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGGAATTGACTAATTCCCCTGATGATTGGCGCCCCCGACATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGGCTCCTCCCTCCCTCTTTTCTTCTCTTGCTGGCATCCTCGGGCGTCGAAGCGGGGGCAGGGACGGGATGAACGGTGTACCCTCCACTAGCCGGCAACCTTGCACACGCCGGAGCATCCGTTGACCTAACCATCTTCTCTCTCCACCTTGCAGGCATCTCTTCTATCCTCGGAGCAATTAACTTCATTACTACCATCCTTAACATAAAACCCCCTGCCGTCTCTCAGTATCAAACACCCTTGTTCGTCTGAGCTGTGCTAATCACGGCTGTACTGTTGCTGCTCTCTCTCCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGACCGAAACCTTAACACAACCTTCTTTGACCCTGCAGGGGGAGGAGACCCCATTCTCTATCAGCACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon citrinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gobiodon citrinus

Gobiodon citrinus, the Poison Goby, is a species of goby native to the Indian Ocean from the Red Sea and the coast of Africa to the western Pacific Ocean to Japan, Samoa and the Great Barrier Reef. They are reef dwellers being found at depths of from 2 to 20 metres (6.6 to 66 ft) and in association with Acropora corals. The mucus produced by this fish is toxic. They grow to a length of 6.6 centimetres (2.6 in) TL. They have varied body colour and could be either dark brown, or pale yellow. They also have blue vertical lines that go around their eyes and gills. This species is also found in the aquarium trade and has been reared in the aquarium.

References[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!