Overview

Comprehensive Description

Biology

Associated with colonies of broadly branched corals (Acropora spp.) (Ref. 35408); a coral-commensal species (Ref. 72446). Produces toxic mucus (Ref. 9360, 48637).Has been reared in captivity (Ref. 35408).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea south to Delagoa Bay, Mozambique and east to Samoa, north to southern Japan, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Africa, Mozambique, Red Sea, Reunion, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Aldabra, Seychelles and Réunion (western Mascarenes) east to Samoa and Tonga, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9 - 11; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 66 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

6.6 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Associated with colonies of broadly branched corals (@Acropora@ spp.).<111>. Species of the genus Gobiodon produce much mucus which contains a toxin; the mucus has a strong bitter taste<307>.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine, usually 2 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 1.525 - 12
  Temperature range (°C): 22.368 - 28.941
  Nitrate (umol/L): 0.047 - 0.622
  Salinity (PPS): 32.279 - 35.552
  Oxygen (ml/l): 4.484 - 5.079
  Phosphate (umol/l): 0.055 - 0.327
  Silicate (umol/l): 0.910 - 4.452

Graphical representation

Depth range (m): 1.525 - 12

Temperature range (°C): 22.368 - 28.941

Nitrate (umol/L): 0.047 - 0.622

Salinity (PPS): 32.279 - 35.552

Oxygen (ml/l): 4.484 - 5.079

Phosphate (umol/l): 0.055 - 0.327

Silicate (umol/l): 0.910 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon citrinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTCTACTTGGTCTTTGGTGCCTGGGCCGGGATAGTAGGGACTGCTCTAAGCCTGCTCATTCGAGCCGAGCTGAGCCAACCTGGGGCACTACTTGGAGACGACCAGGTCTATAACGTAATTGTTACTGCGCACGCCTTTGTGATGATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGGAATTGACTAATTCCCCTGATGATTGGCGCCCCCGACATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGGCTCCTCCCTCCCTCTTTTCTTCTCTTGCTGGCATCCTCGGGCGTCGAAGCGGGGGCAGGGACGGGATGAACGGTGTACCCTCCACTAGCCGGCAACCTTGCACACGCCGGAGCATCCGTTGACCTAACCATCTTCTCTCTCCACCTTGCAGGCATCTCTTCTATCCTCGGAGCAATTAACTTCATTACTACCATCCTTAACATAAAACCCCCTGCCGTCTCTCAGTATCAAACACCCTTGTTCGTCTGAGCTGTGCTAATCACGGCTGTACTGTTGCTGCTCTCTCTCCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGACCGAAACCTTAACACAACCTTCTTTGACCCTGCAGGGGGAGGAGACCCCATTCTCTATCAGCACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon citrinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gobiodon citrinus

Gobiodon citrinus (also known as Clown Goby[1] and either Poison or Citrin Goby)[2] is a Goby from the Indo-West Pacific. The species could be found in such countries as Fiji and Sri Lanka.[3] It occasionally makes its way into the aquarium trade. They grow to a size of 6.6 centimetres (2.6 in) in length. They have varied body colour and could be either dark brown, or pale yellow. They also have blue vertical lines that go around their eyes and gills. The species feed on mysid shrimp and brine shrimp, when kept in aquarium.[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!